FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638713_at:

>probe:Drosophila_2:1638713_at:601:29; Interrogation_Position=103; Antisense; ATAAATAAGTTGCTCGCGCGATCGA
>probe:Drosophila_2:1638713_at:146:165; Interrogation_Position=105; Antisense; AAATAAGTTGCTCGCGCGATCGATT
>probe:Drosophila_2:1638713_at:632:215; Interrogation_Position=109; Antisense; AAGTTGCTCGCGCGATCGATTTACT
>probe:Drosophila_2:1638713_at:108:193; Interrogation_Position=181; Antisense; AACTATACAGCCCTGCCAAGGGACC
>probe:Drosophila_2:1638713_at:324:79; Interrogation_Position=199; Antisense; AGGGACCAACCTCCCTTGATGACCT
>probe:Drosophila_2:1638713_at:724:281; Interrogation_Position=209; Antisense; CTCCCTTGATGACCTGCAACGGTTG
>probe:Drosophila_2:1638713_at:101:607; Interrogation_Position=215; Antisense; TGATGACCTGCAACGGTTGCTGCGT
>probe:Drosophila_2:1638713_at:705:305; Interrogation_Position=221; Antisense; CCTGCAACGGTTGCTGCGTGAAAAT
>probe:Drosophila_2:1638713_at:34:337; Interrogation_Position=233; Antisense; GCTGCGTGAAAATGGTGCGGCATCA
>probe:Drosophila_2:1638713_at:630:183; Interrogation_Position=241; Antisense; AAAATGGTGCGGCATCAGAGATCAC
>probe:Drosophila_2:1638713_at:587:567; Interrogation_Position=251; Antisense; GGCATCAGAGATCACCGTACGAGGT
>probe:Drosophila_2:1638713_at:100:261; Interrogation_Position=263; Antisense; CACCGTACGAGGTGGTGCGACGCAT
>probe:Drosophila_2:1638713_at:382:481; Interrogation_Position=80; Antisense; GTATTAACAGCAAAAAGAACCGCAT
>probe:Drosophila_2:1638713_at:228:381; Interrogation_Position=96; Antisense; GAACCGCATAAATAAGTTGCTCGCG

Paste this into a BLAST search page for me
ATAAATAAGTTGCTCGCGCGATCGAAAATAAGTTGCTCGCGCGATCGATTAAGTTGCTCGCGCGATCGATTTACTAACTATACAGCCCTGCCAAGGGACCAGGGACCAACCTCCCTTGATGACCTCTCCCTTGATGACCTGCAACGGTTGTGATGACCTGCAACGGTTGCTGCGTCCTGCAACGGTTGCTGCGTGAAAATGCTGCGTGAAAATGGTGCGGCATCAAAAATGGTGCGGCATCAGAGATCACGGCATCAGAGATCACCGTACGAGGTCACCGTACGAGGTGGTGCGACGCATGTATTAACAGCAAAAAGAACCGCATGAACCGCATAAATAAGTTGCTCGCG

Full Affymetrix probeset data:

Annotations for 1638713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720