FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638714_at:

>probe:Drosophila_2:1638714_at:165:225; Interrogation_Position=393; Antisense; AAGGATCCAATCAAAGTGCGCTCAA
>probe:Drosophila_2:1638714_at:674:221; Interrogation_Position=416; Antisense; AAGGCCCTGCAACAGAGGTTACTAA
>probe:Drosophila_2:1638714_at:653:237; Interrogation_Position=451; Antisense; CAATAGTTTACTTCTCCGGAACCAT
>probe:Drosophila_2:1638714_at:394:563; Interrogation_Position=468; Antisense; GGAACCATTCCATATACTTGATGAA
>probe:Drosophila_2:1638714_at:662:101; Interrogation_Position=550; Antisense; AGAGCTCGAGCTAAATACTGTGAAC
>probe:Drosophila_2:1638714_at:315:669; Interrogation_Position=565; Antisense; TACTGTGAACCGCAGACTTTTGGAA
>probe:Drosophila_2:1638714_at:53:595; Interrogation_Position=595; Antisense; TGGGCAACTGCAAAACACTCGAAAG
>probe:Drosophila_2:1638714_at:186:469; Interrogation_Position=642; Antisense; GTTCTAGTAAGGATAGCGCCCCACC
>probe:Drosophila_2:1638714_at:289:621; Interrogation_Position=667; Antisense; TGCCGCCAATCAGTTTCAGGAAGCC
>probe:Drosophila_2:1638714_at:389:561; Interrogation_Position=685; Antisense; GGAAGCCAACGTCAGGAACACTTAC
>probe:Drosophila_2:1638714_at:638:671; Interrogation_Position=778; Antisense; TACCGATGTACCCACGGAGACAAAT
>probe:Drosophila_2:1638714_at:22:553; Interrogation_Position=793; Antisense; GGAGACAAATCCTTCCCAAGGGAAT
>probe:Drosophila_2:1638714_at:374:211; Interrogation_Position=894; Antisense; AAGACCTTCTAATTGCGCACTTACT
>probe:Drosophila_2:1638714_at:430:17; Interrogation_Position=920; Antisense; ATTTTTCTGATCTTGTTAGCCGTAA

Paste this into a BLAST search page for me
AAGGATCCAATCAAAGTGCGCTCAAAAGGCCCTGCAACAGAGGTTACTAACAATAGTTTACTTCTCCGGAACCATGGAACCATTCCATATACTTGATGAAAGAGCTCGAGCTAAATACTGTGAACTACTGTGAACCGCAGACTTTTGGAATGGGCAACTGCAAAACACTCGAAAGGTTCTAGTAAGGATAGCGCCCCACCTGCCGCCAATCAGTTTCAGGAAGCCGGAAGCCAACGTCAGGAACACTTACTACCGATGTACCCACGGAGACAAATGGAGACAAATCCTTCCCAAGGGAATAAGACCTTCTAATTGCGCACTTACTATTTTTCTGATCTTGTTAGCCGTAA

Full Affymetrix probeset data:

Annotations for 1638714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720