Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638716_a_at:

>probe:Drosophila_2:1638716_a_at:72:203; Interrogation_Position=292; Antisense; AACCGTGGTTTGTCATCGTTCTGTT
>probe:Drosophila_2:1638716_a_at:615:473; Interrogation_Position=314; Antisense; GTTACGATCGCACGTGCACCAAGTA
>probe:Drosophila_2:1638716_a_at:328:211; Interrogation_Position=334; Antisense; AAGTACGTTCTCTGCTTCGACGGCA
>probe:Drosophila_2:1638716_a_at:60:87; Interrogation_Position=374; Antisense; AGTGCTCCGATGGACTGCAGTACAA
>probe:Drosophila_2:1638716_a_at:404:45; Interrogation_Position=410; Antisense; ATCGCTGTGACTATCCGCAGTATGT
>probe:Drosophila_2:1638716_a_at:36:501; Interrogation_Position=433; Antisense; GTCGACTGCGTGGACAATCTGTGCA
>probe:Drosophila_2:1638716_a_at:522:611; Interrogation_Position=477; Antisense; TGACATCGTTTTCATACCCAGCAAG
>probe:Drosophila_2:1638716_a_at:451:361; Interrogation_Position=497; Antisense; GCAAGGCTCGCTGTGACAAGTACTA
>probe:Drosophila_2:1638716_a_at:338:547; Interrogation_Position=531; Antisense; GGATGGTCTTCCTCAAGTCCAGAAC
>probe:Drosophila_2:1638716_a_at:610:83; Interrogation_Position=562; Antisense; AGTGGCCTGCAGTACAATCCAAGCA
>probe:Drosophila_2:1638716_a_at:373:193; Interrogation_Position=616; Antisense; AACTGCACGGTGGAGAGCCTTCAAC
>probe:Drosophila_2:1638716_a_at:336:703; Interrogation_Position=713; Antisense; TTATTGCCCACCAGAAGCGTCAGGA
>probe:Drosophila_2:1638716_a_at:379:547; Interrogation_Position=735; Antisense; GGATGCGTACTACTACTGCCTGAAT
>probe:Drosophila_2:1638716_a_at:593:279; Interrogation_Position=835; Antisense; CTCGTGGGCTTCTAGTTACTCGAAA

Paste this into a BLAST search page for me
AACCGTGGTTTGTCATCGTTCTGTTGTTACGATCGCACGTGCACCAAGTAAAGTACGTTCTCTGCTTCGACGGCAAGTGCTCCGATGGACTGCAGTACAAATCGCTGTGACTATCCGCAGTATGTGTCGACTGCGTGGACAATCTGTGCATGACATCGTTTTCATACCCAGCAAGGCAAGGCTCGCTGTGACAAGTACTAGGATGGTCTTCCTCAAGTCCAGAACAGTGGCCTGCAGTACAATCCAAGCAAACTGCACGGTGGAGAGCCTTCAACTTATTGCCCACCAGAAGCGTCAGGAGGATGCGTACTACTACTGCCTGAATCTCGTGGGCTTCTAGTTACTCGAAA

Full Affymetrix probeset data:

Annotations for 1638716_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime