FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638717_at:

>probe:Drosophila_2:1638717_at:68:119; Interrogation_Position=1030; Antisense; AGCTCTGGCCATTCCCAAATTACTG
>probe:Drosophila_2:1638717_at:450:251; Interrogation_Position=1045; Antisense; CAAATTACTGAAGCGTGCCGGCGTT
>probe:Drosophila_2:1638717_at:211:633; Interrogation_Position=1112; Antisense; TCCCTGGTCGTTTTGGCCAATATCA
>probe:Drosophila_2:1638717_at:566:543; Interrogation_Position=1150; Antisense; GGATCCAGCCAAGGTTAATGTTCAT
>probe:Drosophila_2:1638717_at:248:549; Interrogation_Position=1175; Antisense; GGAGGTGCCGTGTCAATTGGCCATC
>probe:Drosophila_2:1638717_at:311:729; Interrogation_Position=1191; Antisense; TTGGCCATCCAATCGGCATGTCCGG
>probe:Drosophila_2:1638717_at:137:309; Interrogation_Position=1231; Antisense; CCATCTTTCGCACAGCCTGAAGAAG
>probe:Drosophila_2:1638717_at:563:591; Interrogation_Position=1263; Antisense; TGGGATGCGCCTCCATTTGCAATGG
>probe:Drosophila_2:1638717_at:415:555; Interrogation_Position=1340; Antisense; GGACCTGCTCTCAACCAGAAATGCA
>probe:Drosophila_2:1638717_at:496:617; Interrogation_Position=1361; Antisense; TGCATTTACTACTGATCCATCGAGA
>probe:Drosophila_2:1638717_at:18:711; Interrogation_Position=1421; Antisense; TTAAGTGTCTTGATTGCGCGTGGCC
>probe:Drosophila_2:1638717_at:259:625; Interrogation_Position=913; Antisense; TGCCGCCGTGGTTTTGATGAGTGCC
>probe:Drosophila_2:1638717_at:655:727; Interrogation_Position=978; Antisense; TTGTGGCCTTCCAGGATGCGGAGAC
>probe:Drosophila_2:1638717_at:302:49; Interrogation_Position=993; Antisense; ATGCGGAGACCGATCCCATTGACTT

Paste this into a BLAST search page for me
AGCTCTGGCCATTCCCAAATTACTGCAAATTACTGAAGCGTGCCGGCGTTTCCCTGGTCGTTTTGGCCAATATCAGGATCCAGCCAAGGTTAATGTTCATGGAGGTGCCGTGTCAATTGGCCATCTTGGCCATCCAATCGGCATGTCCGGCCATCTTTCGCACAGCCTGAAGAAGTGGGATGCGCCTCCATTTGCAATGGGGACCTGCTCTCAACCAGAAATGCATGCATTTACTACTGATCCATCGAGATTAAGTGTCTTGATTGCGCGTGGCCTGCCGCCGTGGTTTTGATGAGTGCCTTGTGGCCTTCCAGGATGCGGAGACATGCGGAGACCGATCCCATTGACTT

Full Affymetrix probeset data:

Annotations for 1638717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720