Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638721_s_at:

>probe:Drosophila_2:1638721_s_at:186:671; Interrogation_Position=100; Antisense; TACGGCGCAGTGATATTCTTTCCCA
>probe:Drosophila_2:1638721_s_at:529:19; Interrogation_Position=112; Antisense; ATATTCTTTCCCACTGTTGCAGTCG
>probe:Drosophila_2:1638721_s_at:301:469; Interrogation_Position=127; Antisense; GTTGCAGTCGGATCGATTTACGCAG
>probe:Drosophila_2:1638721_s_at:639:459; Interrogation_Position=141; Antisense; GATTTACGCAGATTGGTCGCACACC
>probe:Drosophila_2:1638721_s_at:334:95; Interrogation_Position=191; Antisense; AGTTGGCACACCGAGCCCAGCTGAA
>probe:Drosophila_2:1638721_s_at:292:23; Interrogation_Position=241; Antisense; ATATACACCATGGTCTTGGGACTGG
>probe:Drosophila_2:1638721_s_at:482:729; Interrogation_Position=256; Antisense; TTGGGACTGGATAAGCGAGCACTGT
>probe:Drosophila_2:1638721_s_at:510:469; Interrogation_Position=288; Antisense; GTTGCCCCTGCTGGGATTTGCCATT
>probe:Drosophila_2:1638721_s_at:466:307; Interrogation_Position=308; Antisense; CCATTGGCCACTTCCTGGACAAGAA
>probe:Drosophila_2:1638721_s_at:459:197; Interrogation_Position=341; Antisense; AACGTATGACCATGTTCCGGGACAA
>probe:Drosophila_2:1638721_s_at:594:395; Interrogation_Position=361; Antisense; GACAAGAGTGCCCTATACGGCCGTC
>probe:Drosophila_2:1638721_s_at:652:535; Interrogation_Position=400; Antisense; GGTAAGGCGCCATCCTGGTAGGCCT
>probe:Drosophila_2:1638721_s_at:348:255; Interrogation_Position=428; Antisense; CAACATCGCCATCCCAAAATATTAT
>probe:Drosophila_2:1638721_s_at:49:249; Interrogation_Position=86; Antisense; AATTGGCTCGAAAGTACGGCGCAGT

Paste this into a BLAST search page for me
TACGGCGCAGTGATATTCTTTCCCAATATTCTTTCCCACTGTTGCAGTCGGTTGCAGTCGGATCGATTTACGCAGGATTTACGCAGATTGGTCGCACACCAGTTGGCACACCGAGCCCAGCTGAAATATACACCATGGTCTTGGGACTGGTTGGGACTGGATAAGCGAGCACTGTGTTGCCCCTGCTGGGATTTGCCATTCCATTGGCCACTTCCTGGACAAGAAAACGTATGACCATGTTCCGGGACAAGACAAGAGTGCCCTATACGGCCGTCGGTAAGGCGCCATCCTGGTAGGCCTCAACATCGCCATCCCAAAATATTATAATTGGCTCGAAAGTACGGCGCAGT

Full Affymetrix probeset data:

Annotations for 1638721_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime