FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638724_at:

>probe:Drosophila_2:1638724_at:522:69; Interrogation_Position=1623; Antisense; AGGCCGTGGCCCAGGAGCTGTTTCT
>probe:Drosophila_2:1638724_at:92:333; Interrogation_Position=1639; Antisense; GCTGTTTCTGAGCTACCTGCAGCGC
>probe:Drosophila_2:1638724_at:58:625; Interrogation_Position=1680; Antisense; TGCGCCGCCGTCTGGATTGGACTGT
>probe:Drosophila_2:1638724_at:50:641; Interrogation_Position=1690; Antisense; TCTGGATTGGACTGTCCAGGAGGCC
>probe:Drosophila_2:1638724_at:615:39; Interrogation_Position=1737; Antisense; ATCTGCAATCGTCCATCTGTCCGTG
>probe:Drosophila_2:1638724_at:436:39; Interrogation_Position=1751; Antisense; ATCTGTCCGTGCCAATACGAGGAGG
>probe:Drosophila_2:1638724_at:330:29; Interrogation_Position=1765; Antisense; ATACGAGGAGGAGTTGTTGCGCAAC
>probe:Drosophila_2:1638724_at:321:97; Interrogation_Position=1791; Antisense; AGATCAAGATCAGCCTGCAGCACCG
>probe:Drosophila_2:1638724_at:520:143; Interrogation_Position=1818; Antisense; ACTGCTGCGGCATCAACTGCATGGG
>probe:Drosophila_2:1638724_at:287:195; Interrogation_Position=1832; Antisense; AACTGCATGGGCTGCTGGCTCTAAT
>probe:Drosophila_2:1638724_at:463:583; Interrogation_Position=1847; Antisense; TGGCTCTAATCCCTGACATGTAATC
>probe:Drosophila_2:1638724_at:148:233; Interrogation_Position=1854; Antisense; AATCCCTGACATGTAATCCTCAAAA
>probe:Drosophila_2:1638724_at:682:165; Interrogation_Position=1878; Antisense; AAATGTTTCGTTTCTTAGATTGCCG
>probe:Drosophila_2:1638724_at:570:297; Interrogation_Position=1900; Antisense; CCGAGAATCTATTAAATGCCTAGCC

Paste this into a BLAST search page for me
AGGCCGTGGCCCAGGAGCTGTTTCTGCTGTTTCTGAGCTACCTGCAGCGCTGCGCCGCCGTCTGGATTGGACTGTTCTGGATTGGACTGTCCAGGAGGCCATCTGCAATCGTCCATCTGTCCGTGATCTGTCCGTGCCAATACGAGGAGGATACGAGGAGGAGTTGTTGCGCAACAGATCAAGATCAGCCTGCAGCACCGACTGCTGCGGCATCAACTGCATGGGAACTGCATGGGCTGCTGGCTCTAATTGGCTCTAATCCCTGACATGTAATCAATCCCTGACATGTAATCCTCAAAAAAATGTTTCGTTTCTTAGATTGCCGCCGAGAATCTATTAAATGCCTAGCC

Full Affymetrix probeset data:

Annotations for 1638724_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720