FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638725_at:

>probe:Drosophila_2:1638725_at:135:249; Interrogation_Position=2505; Antisense; CAATAGTTTCCTTAACCTCGTGCAA
>probe:Drosophila_2:1638725_at:182:221; Interrogation_Position=2543; Antisense; AAGGGAAACTGCTGCCGAGTCATCT
>probe:Drosophila_2:1638725_at:424:651; Interrogation_Position=2590; Antisense; TCAAGTCCGGTCCAGCATCAGCGAT
>probe:Drosophila_2:1638725_at:710:33; Interrogation_Position=2606; Antisense; ATCAGCGATCTCTGTCGAGTGCGGC
>probe:Drosophila_2:1638725_at:698:41; Interrogation_Position=2688; Antisense; ATCGGTGGCCGCTTATGATTATCAT
>probe:Drosophila_2:1638725_at:184:51; Interrogation_Position=2711; Antisense; ATGCCGCGCAGCTGGAGAGGTTTCT
>probe:Drosophila_2:1638725_at:88:375; Interrogation_Position=2737; Antisense; GAAGAGTACCGCAACCTGCAGGATC
>probe:Drosophila_2:1638725_at:105:551; Interrogation_Position=2778; Antisense; GGAGACCTGCGATACGATCCGTAAA
>probe:Drosophila_2:1638725_at:371:225; Interrogation_Position=2803; Antisense; AAGGAGACTCCTTTGCGAGTGGCCA
>probe:Drosophila_2:1638725_at:692:447; Interrogation_Position=2854; Antisense; GATCCCGTAATGTACAGTGCAGCCT
>probe:Drosophila_2:1638725_at:657:317; Interrogation_Position=2895; Antisense; GCCGGCGACCAGCAATCTGAAGACA
>probe:Drosophila_2:1638725_at:144:611; Interrogation_Position=2912; Antisense; TGAAGACAAAGACCCTACTCCCAGG
>probe:Drosophila_2:1638725_at:121:469; Interrogation_Position=2964; Antisense; GTTGCACCGGAACGCCATGTTGAAG
>probe:Drosophila_2:1638725_at:100:229; Interrogation_Position=3019; Antisense; AATGGTTCAGGTGGATCTCCCGCCT

Paste this into a BLAST search page for me
CAATAGTTTCCTTAACCTCGTGCAAAAGGGAAACTGCTGCCGAGTCATCTTCAAGTCCGGTCCAGCATCAGCGATATCAGCGATCTCTGTCGAGTGCGGCATCGGTGGCCGCTTATGATTATCATATGCCGCGCAGCTGGAGAGGTTTCTGAAGAGTACCGCAACCTGCAGGATCGGAGACCTGCGATACGATCCGTAAAAAGGAGACTCCTTTGCGAGTGGCCAGATCCCGTAATGTACAGTGCAGCCTGCCGGCGACCAGCAATCTGAAGACATGAAGACAAAGACCCTACTCCCAGGGTTGCACCGGAACGCCATGTTGAAGAATGGTTCAGGTGGATCTCCCGCCT

Full Affymetrix probeset data:

Annotations for 1638725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720