FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638726_at:

>probe:Drosophila_2:1638726_at:294:85; Interrogation_Position=388; Antisense; AGTGCCCATTTACGTCCAGGGAGGA
>probe:Drosophila_2:1638726_at:437:77; Interrogation_Position=409; Antisense; AGGAGGACACACCATTAGCGCGGCC
>probe:Drosophila_2:1638726_at:559:577; Interrogation_Position=430; Antisense; GGCCGATGTGCAGCGCCAGATGAAC
>probe:Drosophila_2:1638726_at:431:375; Interrogation_Position=520; Antisense; GAAGACCAACACCATCCTGGAGAAG
>probe:Drosophila_2:1638726_at:303:371; Interrogation_Position=541; Antisense; GAAGGAGTACGCCAATGCTGTAGAA
>probe:Drosophila_2:1638726_at:323:75; Interrogation_Position=621; Antisense; AGGACCTGAAATCCCAGCTGCTTGC
>probe:Drosophila_2:1638726_at:503:81; Interrogation_Position=690; Antisense; AGGTGGCCCAATTCCGACAGTGCAT
>probe:Drosophila_2:1638726_at:180:401; Interrogation_Position=705; Antisense; GACAGTGCATCGATCTTCATCGCGT
>probe:Drosophila_2:1638726_at:106:543; Interrogation_Position=739; Antisense; GGATGCGGAACCAGAGTCGTCGAAA
>probe:Drosophila_2:1638726_at:555:475; Interrogation_Position=754; Antisense; GTCGTCGAAAGTGACCTCCAAGGCC
>probe:Drosophila_2:1638726_at:426:227; Interrogation_Position=791; Antisense; AAGGCGGCCTAGGATCCTGGCAAAT
>probe:Drosophila_2:1638726_at:536:287; Interrogation_Position=807; Antisense; CTGGCAAATCCTTTTGTCCTAATTT
>probe:Drosophila_2:1638726_at:31:697; Interrogation_Position=830; Antisense; TTGTTGACTTTTCTTTGAGGCCCCT
>probe:Drosophila_2:1638726_at:548:605; Interrogation_Position=845; Antisense; TGAGGCCCCTTATGGGTTTTGTATA

Paste this into a BLAST search page for me
AGTGCCCATTTACGTCCAGGGAGGAAGGAGGACACACCATTAGCGCGGCCGGCCGATGTGCAGCGCCAGATGAACGAAGACCAACACCATCCTGGAGAAGGAAGGAGTACGCCAATGCTGTAGAAAGGACCTGAAATCCCAGCTGCTTGCAGGTGGCCCAATTCCGACAGTGCATGACAGTGCATCGATCTTCATCGCGTGGATGCGGAACCAGAGTCGTCGAAAGTCGTCGAAAGTGACCTCCAAGGCCAAGGCGGCCTAGGATCCTGGCAAATCTGGCAAATCCTTTTGTCCTAATTTTTGTTGACTTTTCTTTGAGGCCCCTTGAGGCCCCTTATGGGTTTTGTATA

Full Affymetrix probeset data:

Annotations for 1638726_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720