FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638728_at:

>probe:Drosophila_2:1638728_at:647:151; Interrogation_Position=1016; Antisense; ACATCTCACAGCGACGGTGCGAGGA
>probe:Drosophila_2:1638728_at:698:485; Interrogation_Position=1049; Antisense; GTAGCGAGGCGGTCACTGTGCATCA
>probe:Drosophila_2:1638728_at:331:93; Interrogation_Position=1154; Antisense; AGTTACGCGGCCAGCTGATGGAGTC
>probe:Drosophila_2:1638728_at:703:431; Interrogation_Position=1174; Antisense; GAGTCGTACCTCAAGCGTATGCAGC
>probe:Drosophila_2:1638728_at:210:329; Interrogation_Position=1188; Antisense; GCGTATGCAGCTCGACAACTACATG
>probe:Drosophila_2:1638728_at:715:267; Interrogation_Position=1269; Antisense; CAGGGATCAGCTCCGCGAGGATATT
>probe:Drosophila_2:1638728_at:459:689; Interrogation_Position=1290; Antisense; TATTGAACGCAAACGCCATCAGTCC
>probe:Drosophila_2:1638728_at:536:35; Interrogation_Position=1307; Antisense; ATCAGTCCCAGCGTTTCGTTGAGTG
>probe:Drosophila_2:1638728_at:144:577; Interrogation_Position=1340; Antisense; GGCGCCAAAATGATCGCTTCCGTAC
>probe:Drosophila_2:1638728_at:52:253; Interrogation_Position=1368; Antisense; CAAGATCTCTGCCAGTCTGCGGGAG
>probe:Drosophila_2:1638728_at:345:639; Interrogation_Position=1405; Antisense; TCGGTCACACCAGAAGGCGCTATTA
>probe:Drosophila_2:1638728_at:577:279; Interrogation_Position=1459; Antisense; CTCAACTCATATGTCCAGCAGCAGA
>probe:Drosophila_2:1638728_at:326:95; Interrogation_Position=1481; Antisense; AGATAAAGCTGGGTCGCCTGCTCTT
>probe:Drosophila_2:1638728_at:467:619; Interrogation_Position=1499; Antisense; TGCTCTTCGAACAATCTGCCAGGGA

Paste this into a BLAST search page for me
ACATCTCACAGCGACGGTGCGAGGAGTAGCGAGGCGGTCACTGTGCATCAAGTTACGCGGCCAGCTGATGGAGTCGAGTCGTACCTCAAGCGTATGCAGCGCGTATGCAGCTCGACAACTACATGCAGGGATCAGCTCCGCGAGGATATTTATTGAACGCAAACGCCATCAGTCCATCAGTCCCAGCGTTTCGTTGAGTGGGCGCCAAAATGATCGCTTCCGTACCAAGATCTCTGCCAGTCTGCGGGAGTCGGTCACACCAGAAGGCGCTATTACTCAACTCATATGTCCAGCAGCAGAAGATAAAGCTGGGTCGCCTGCTCTTTGCTCTTCGAACAATCTGCCAGGGA

Full Affymetrix probeset data:

Annotations for 1638728_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720