FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638729_at:

>probe:Drosophila_2:1638729_at:398:49; Interrogation_Position=1360; Antisense; ATGCCACTGTTTTTGATAACTACGG
>probe:Drosophila_2:1638729_at:521:453; Interrogation_Position=1384; Antisense; GATCATCTTTGTGTGGTCCGCTGTA
>probe:Drosophila_2:1638729_at:313:137; Interrogation_Position=1465; Antisense; ACGATCGAGGTTGAGCTGGTTGACA
>probe:Drosophila_2:1638729_at:331:401; Interrogation_Position=1495; Antisense; GACATAATCCGCGTGAGCCAACAGA
>probe:Drosophila_2:1638729_at:288:91; Interrogation_Position=1526; Antisense; AGTTTTTGATCAAGCCGTTTGCCTT
>probe:Drosophila_2:1638729_at:665:257; Interrogation_Position=1556; Antisense; CACGTCAATGTTTGGCGGGTCGATT
>probe:Drosophila_2:1638729_at:219:581; Interrogation_Position=1568; Antisense; TGGCGGGTCGATTGGCGTTTATAAC
>probe:Drosophila_2:1638729_at:158:477; Interrogation_Position=1584; Antisense; GTTTATAACGCAGTGTAAGTCTCCA
>probe:Drosophila_2:1638729_at:365:493; Interrogation_Position=1598; Antisense; GTAAGTCTCCAAACTGGACCGCAGA
>probe:Drosophila_2:1638729_at:16:459; Interrogation_Position=1642; Antisense; GATATGATATTATTGCGCCTGCTTT
>probe:Drosophila_2:1638729_at:61:697; Interrogation_Position=1664; Antisense; TTTACGCCAAGGTCGAAGCTATTAA
>probe:Drosophila_2:1638729_at:527:185; Interrogation_Position=1693; Antisense; AACACTGCCTATCTTGTGCTAGTTG
>probe:Drosophila_2:1638729_at:612:449; Interrogation_Position=1754; Antisense; GATCGCTCATAGAAACTGGTTGGGT
>probe:Drosophila_2:1638729_at:214:461; Interrogation_Position=1898; Antisense; GATTATGTTTCCCACAGTATGACTT

Paste this into a BLAST search page for me
ATGCCACTGTTTTTGATAACTACGGGATCATCTTTGTGTGGTCCGCTGTAACGATCGAGGTTGAGCTGGTTGACAGACATAATCCGCGTGAGCCAACAGAAGTTTTTGATCAAGCCGTTTGCCTTCACGTCAATGTTTGGCGGGTCGATTTGGCGGGTCGATTGGCGTTTATAACGTTTATAACGCAGTGTAAGTCTCCAGTAAGTCTCCAAACTGGACCGCAGAGATATGATATTATTGCGCCTGCTTTTTTACGCCAAGGTCGAAGCTATTAAAACACTGCCTATCTTGTGCTAGTTGGATCGCTCATAGAAACTGGTTGGGTGATTATGTTTCCCACAGTATGACTT

Full Affymetrix probeset data:

Annotations for 1638729_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720