FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638730_at:

>probe:Drosophila_2:1638730_at:15:425; Interrogation_Position=1012; Antisense; GAGACTGCCAATGTGGATGAACCCA
>probe:Drosophila_2:1638730_at:278:233; Interrogation_Position=1042; Antisense; AATCCCGTTATAAGCATCGAAGAGG
>probe:Drosophila_2:1638730_at:49:613; Interrogation_Position=1083; Antisense; TGCAAATGCCAACGAAGTGCCCGTT
>probe:Drosophila_2:1638730_at:154:373; Interrogation_Position=1096; Antisense; GAAGTGCCCGTTGCCTCGAATAACG
>probe:Drosophila_2:1638730_at:82:241; Interrogation_Position=1114; Antisense; AATAACGGCAATGGAGCAGTCGCAG
>probe:Drosophila_2:1638730_at:522:77; Interrogation_Position=1145; Antisense; AGGATGTGGAAATGCCGCTGGCCAA
>probe:Drosophila_2:1638730_at:228:197; Interrogation_Position=1259; Antisense; AACTGGCAGCCGTAGATGCGGCCAT
>probe:Drosophila_2:1638730_at:576:445; Interrogation_Position=1273; Antisense; GATGCGGCCATTCTACTGGCCAAAA
>probe:Drosophila_2:1638730_at:420:127; Interrogation_Position=1314; Antisense; AGCCACTGCAGCCAAAACCGAGGAA
>probe:Drosophila_2:1638730_at:480:149; Interrogation_Position=757; Antisense; ACTTCCACTTTAAATCCGACTGCAC
>probe:Drosophila_2:1638730_at:42:309; Interrogation_Position=875; Antisense; CCATTTCCAATGAGGCTGCTGCTGC
>probe:Drosophila_2:1638730_at:608:335; Interrogation_Position=901; Antisense; GCTGCTGTTGCAGTGGAAGCCCCTT
>probe:Drosophila_2:1638730_at:517:73; Interrogation_Position=933; Antisense; AGGAACCACTTCCAGTGCCAACAAT
>probe:Drosophila_2:1638730_at:653:83; Interrogation_Position=980; Antisense; AGTCCATGGAAGTGGCGTTGGCCAA

Paste this into a BLAST search page for me
GAGACTGCCAATGTGGATGAACCCAAATCCCGTTATAAGCATCGAAGAGGTGCAAATGCCAACGAAGTGCCCGTTGAAGTGCCCGTTGCCTCGAATAACGAATAACGGCAATGGAGCAGTCGCAGAGGATGTGGAAATGCCGCTGGCCAAAACTGGCAGCCGTAGATGCGGCCATGATGCGGCCATTCTACTGGCCAAAAAGCCACTGCAGCCAAAACCGAGGAAACTTCCACTTTAAATCCGACTGCACCCATTTCCAATGAGGCTGCTGCTGCGCTGCTGTTGCAGTGGAAGCCCCTTAGGAACCACTTCCAGTGCCAACAATAGTCCATGGAAGTGGCGTTGGCCAA

Full Affymetrix probeset data:

Annotations for 1638730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720