FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638731_at:

>probe:Drosophila_2:1638731_at:273:17; Interrogation_Position=1435; Antisense; ATTTTTGGTGCGGAGCTGCCACAGC
>probe:Drosophila_2:1638731_at:66:115; Interrogation_Position=1457; Antisense; AGCATCGACCACATGGCTTACTTAG
>probe:Drosophila_2:1638731_at:6:705; Interrogation_Position=1478; Antisense; TTAGCGTGGAGCACTCAGCTTCGGA
>probe:Drosophila_2:1638731_at:543:275; Interrogation_Position=1528; Antisense; CTTAATCTGCTGGTGGCTTTCCGAC
>probe:Drosophila_2:1638731_at:200:237; Interrogation_Position=1566; Antisense; AATCTCGCTGATCGGCAAGTGCATT
>probe:Drosophila_2:1638731_at:730:195; Interrogation_Position=1598; Antisense; AACTGGGTGCGCCACTTGACGAGAT
>probe:Drosophila_2:1638731_at:377:211; Interrogation_Position=1645; Antisense; AAGAACGCATCCATTCCGCTGAATG
>probe:Drosophila_2:1638731_at:39:369; Interrogation_Position=1665; Antisense; GAATGTGGTGCGCTAAAATGCCTTA
>probe:Drosophila_2:1638731_at:552:493; Interrogation_Position=1697; Antisense; GTAATCTGTCCTTATTTATGGTGCA
>probe:Drosophila_2:1638731_at:135:591; Interrogation_Position=1715; Antisense; TGGTGCAAGCAATCTATCCGTTGTT
>probe:Drosophila_2:1638731_at:315:61; Interrogation_Position=1761; Antisense; ATGTCTGCCAGATGTCCGACTGTAA
>probe:Drosophila_2:1638731_at:57:61; Interrogation_Position=1791; Antisense; ATGTTTCCCTCCTTGGTGCTAAATA
>probe:Drosophila_2:1638731_at:686:657; Interrogation_Position=1830; Antisense; TAAGTCTCTGCCAATCTGTCATAAA
>probe:Drosophila_2:1638731_at:69:373; Interrogation_Position=1916; Antisense; GAAGTTTACTCGTTTGCGTAGCCTA

Paste this into a BLAST search page for me
ATTTTTGGTGCGGAGCTGCCACAGCAGCATCGACCACATGGCTTACTTAGTTAGCGTGGAGCACTCAGCTTCGGACTTAATCTGCTGGTGGCTTTCCGACAATCTCGCTGATCGGCAAGTGCATTAACTGGGTGCGCCACTTGACGAGATAAGAACGCATCCATTCCGCTGAATGGAATGTGGTGCGCTAAAATGCCTTAGTAATCTGTCCTTATTTATGGTGCATGGTGCAAGCAATCTATCCGTTGTTATGTCTGCCAGATGTCCGACTGTAAATGTTTCCCTCCTTGGTGCTAAATATAAGTCTCTGCCAATCTGTCATAAAGAAGTTTACTCGTTTGCGTAGCCTA

Full Affymetrix probeset data:

Annotations for 1638731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720