FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638732_at:

>probe:Drosophila_2:1638732_at:269:627; Interrogation_Position=1050; Antisense; TGCCGGCTTAAAACACTATCCAGAG
>probe:Drosophila_2:1638732_at:466:629; Interrogation_Position=1068; Antisense; TCCAGAGGACACTATCAGCTATCAG
>probe:Drosophila_2:1638732_at:387:239; Interrogation_Position=1113; Antisense; AATCATTGCCGTGGTGCAGTTCATC
>probe:Drosophila_2:1638732_at:688:493; Interrogation_Position=1177; Antisense; GTCAATTTGATGGTGGGCCCGCTGC
>probe:Drosophila_2:1638732_at:253:635; Interrogation_Position=1212; Antisense; TCGCATCTTGCTGGGCGTGATTGTA
>probe:Drosophila_2:1638732_at:331:513; Interrogation_Position=1228; Antisense; GTGATTGTAGCGCTCATCATAGCCC
>probe:Drosophila_2:1638732_at:39:27; Interrogation_Position=1246; Antisense; ATAGCCCTGGCTGAGATGTACTTCC
>probe:Drosophila_2:1638732_at:600:57; Interrogation_Position=1295; Antisense; ATGAGGTCTTGGACGCGCCCAAACG
>probe:Drosophila_2:1638732_at:463:501; Interrogation_Position=1436; Antisense; GTCGTTGTATTATTTCGCTTTGCAA
>probe:Drosophila_2:1638732_at:496:621; Interrogation_Position=878; Antisense; TGCGTCGTCAGGATCACTGCCAAGT
>probe:Drosophila_2:1638732_at:526:627; Interrogation_Position=895; Antisense; TGCCAAGTCTTTCTGCATCAGCTAA
>probe:Drosophila_2:1638732_at:555:247; Interrogation_Position=918; Antisense; AATTGAGTCCTGTGATCTGCTCCTG
>probe:Drosophila_2:1638732_at:485:379; Interrogation_Position=957; Antisense; GAAGCCGCGCAATCCTGAGCTAGAA
>probe:Drosophila_2:1638732_at:586:197; Interrogation_Position=992; Antisense; AACGTCTTCGCGCAGAGCAACAAAA

Paste this into a BLAST search page for me
TGCCGGCTTAAAACACTATCCAGAGTCCAGAGGACACTATCAGCTATCAGAATCATTGCCGTGGTGCAGTTCATCGTCAATTTGATGGTGGGCCCGCTGCTCGCATCTTGCTGGGCGTGATTGTAGTGATTGTAGCGCTCATCATAGCCCATAGCCCTGGCTGAGATGTACTTCCATGAGGTCTTGGACGCGCCCAAACGGTCGTTGTATTATTTCGCTTTGCAATGCGTCGTCAGGATCACTGCCAAGTTGCCAAGTCTTTCTGCATCAGCTAAAATTGAGTCCTGTGATCTGCTCCTGGAAGCCGCGCAATCCTGAGCTAGAAAACGTCTTCGCGCAGAGCAACAAAA

Full Affymetrix probeset data:

Annotations for 1638732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720