FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638733_at:

>probe:Drosophila_2:1638733_at:175:281; Interrogation_Position=1028; Antisense; CTCAGCCATTGGAGCTCGGTAACAT
>probe:Drosophila_2:1638733_at:598:235; Interrogation_Position=1146; Antisense; AATCCCAGAACAAGCCTCCGAAGAG
>probe:Drosophila_2:1638733_at:28:431; Interrogation_Position=1293; Antisense; GAGTCATCATCAGTGCGGTTCCGTC
>probe:Drosophila_2:1638733_at:323:87; Interrogation_Position=1321; Antisense; AGTGCCAGGAAGGTGATGCTCGCTC
>probe:Drosophila_2:1638733_at:191:351; Interrogation_Position=1351; Antisense; GCAGTAGCCAGCTGGACTCAGTCCA
>probe:Drosophila_2:1638733_at:210:405; Interrogation_Position=1365; Antisense; GACTCAGTCCAACAGCCAGATGGTG
>probe:Drosophila_2:1638733_at:455:531; Interrogation_Position=1410; Antisense; GGGTCAGGCCTGTCAGTCCAATAAT
>probe:Drosophila_2:1638733_at:657:31; Interrogation_Position=1430; Antisense; ATAATGGGATTTGCCAGCAGCCCCA
>probe:Drosophila_2:1638733_at:286:385; Interrogation_Position=1455; Antisense; GAACTTCTACGACTGCAGTGGCTGT
>probe:Drosophila_2:1638733_at:118:83; Interrogation_Position=1471; Antisense; AGTGGCTGTGCTATGGGTAACCTTT
>probe:Drosophila_2:1638733_at:460:637; Interrogation_Position=1507; Antisense; TCGTACTGCTACTCCTACAAATGCA
>probe:Drosophila_2:1638733_at:129:113; Interrogation_Position=1531; Antisense; AGCACCCACAACTGCGTATATTACG
>probe:Drosophila_2:1638733_at:284:481; Interrogation_Position=1546; Antisense; GTATATTACGACCAGGCCCAATACT
>probe:Drosophila_2:1638733_at:448:77; Interrogation_Position=1584; Antisense; AGGTCAAACCGGATGCCGTGCGGAA

Paste this into a BLAST search page for me
CTCAGCCATTGGAGCTCGGTAACATAATCCCAGAACAAGCCTCCGAAGAGGAGTCATCATCAGTGCGGTTCCGTCAGTGCCAGGAAGGTGATGCTCGCTCGCAGTAGCCAGCTGGACTCAGTCCAGACTCAGTCCAACAGCCAGATGGTGGGGTCAGGCCTGTCAGTCCAATAATATAATGGGATTTGCCAGCAGCCCCAGAACTTCTACGACTGCAGTGGCTGTAGTGGCTGTGCTATGGGTAACCTTTTCGTACTGCTACTCCTACAAATGCAAGCACCCACAACTGCGTATATTACGGTATATTACGACCAGGCCCAATACTAGGTCAAACCGGATGCCGTGCGGAA

Full Affymetrix probeset data:

Annotations for 1638733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720