Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638734_at:

>probe:Drosophila_2:1638734_at:368:141; Interrogation_Position=2338; Antisense; ACTGATACTCCTGTACCTCTATATA
>probe:Drosophila_2:1638734_at:345:377; Interrogation_Position=2373; Antisense; GAACTGGCCACTGGTTCTTTAACTT
>probe:Drosophila_2:1638734_at:406:53; Interrogation_Position=2450; Antisense; ATGCTTGTGGCCTTTATCCTGCTAA
>probe:Drosophila_2:1638734_at:508:633; Interrogation_Position=2513; Antisense; TACGCATTGGTATCCTTTGGCCGAA
>probe:Drosophila_2:1638734_at:669:109; Interrogation_Position=2538; Antisense; AGAATGTCCGGTCTATCTTCATCTG
>probe:Drosophila_2:1638734_at:434:613; Interrogation_Position=2574; Antisense; TGAACGACGCCATGAGCTTGTACTT
>probe:Drosophila_2:1638734_at:580:343; Interrogation_Position=2589; Antisense; GCTTGTACTTCTGCTACTTTGTGAT
>probe:Drosophila_2:1638734_at:221:539; Interrogation_Position=2662; Antisense; GGTATCCCATGTCTTTATCATTCTG
>probe:Drosophila_2:1638734_at:561:619; Interrogation_Position=2688; Antisense; TGCTTGTGTGCTCCTGGATAGCCAA
>probe:Drosophila_2:1638734_at:267:529; Interrogation_Position=2713; Antisense; GGGTTTCCTGGCCAACACGAAGAAG
>probe:Drosophila_2:1638734_at:567:31; Interrogation_Position=2778; Antisense; ATAATGCCAACTTAGCTCAGGACAG
>probe:Drosophila_2:1638734_at:665:153; Interrogation_Position=2799; Antisense; ACAGTCAGGCTTAGATCGGTCCGGA
>probe:Drosophila_2:1638734_at:537:41; Interrogation_Position=2813; Antisense; ATCGGTCCGGATTATGTGCCAGAAT
>probe:Drosophila_2:1638734_at:128:243; Interrogation_Position=2865; Antisense; AATATGCTGGCCCTGTATCAATGAT

Paste this into a BLAST search page for me
ACTGATACTCCTGTACCTCTATATAGAACTGGCCACTGGTTCTTTAACTTATGCTTGTGGCCTTTATCCTGCTAATACGCATTGGTATCCTTTGGCCGAAAGAATGTCCGGTCTATCTTCATCTGTGAACGACGCCATGAGCTTGTACTTGCTTGTACTTCTGCTACTTTGTGATGGTATCCCATGTCTTTATCATTCTGTGCTTGTGTGCTCCTGGATAGCCAAGGGTTTCCTGGCCAACACGAAGAAGATAATGCCAACTTAGCTCAGGACAGACAGTCAGGCTTAGATCGGTCCGGAATCGGTCCGGATTATGTGCCAGAATAATATGCTGGCCCTGTATCAATGAT

Full Affymetrix probeset data:

Annotations for 1638734_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime