FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638735_at:

>probe:Drosophila_2:1638735_at:323:569; Interrogation_Position=1003; Antisense; GGCAGTCTCAACAACCAAGGAGCTC
>probe:Drosophila_2:1638735_at:325:225; Interrogation_Position=1019; Antisense; AAGGAGCTCTCAAGAGCGCCGCAAA
>probe:Drosophila_2:1638735_at:644:517; Interrogation_Position=1045; Antisense; GTGGGCTACGAGTTCTTCAAGAGTC
>probe:Drosophila_2:1638735_at:539:431; Interrogation_Position=1065; Antisense; GAGTCATGCCTCCAAGATTGCGCAA
>probe:Drosophila_2:1638735_at:46:465; Interrogation_Position=1080; Antisense; GATTGCGCAACTGTTTTCTGTCAAG
>probe:Drosophila_2:1638735_at:261:437; Interrogation_Position=1109; Antisense; GAGGAACTTCTAGTCTGTACTTTTT
>probe:Drosophila_2:1638735_at:453:93; Interrogation_Position=1158; Antisense; AGATTTTAATGCTTTCGGCTCCGGG
>probe:Drosophila_2:1638735_at:88:669; Interrogation_Position=1289; Antisense; TACTTTGCTGCATTTCATTCCGTGT
>probe:Drosophila_2:1638735_at:82:647; Interrogation_Position=1303; Antisense; TCATTCCGTGTGTGCGCGAATCAAA
>probe:Drosophila_2:1638735_at:716:175; Interrogation_Position=1325; Antisense; AAACGGCTGATCTGAACGGAGACAC
>probe:Drosophila_2:1638735_at:95:621; Interrogation_Position=1354; Antisense; TGCTGAACACATTTCCTGCATGCTA
>probe:Drosophila_2:1638735_at:236:721; Interrogation_Position=1366; Antisense; TTCCTGCATGCTACCAAATTCTATT
>probe:Drosophila_2:1638735_at:231:705; Interrogation_Position=1393; Antisense; TTATCGTTACTTATTTGCACTACAT
>probe:Drosophila_2:1638735_at:69:485; Interrogation_Position=988; Antisense; GTATCCACAACAAACGGCAGTCTCA

Paste this into a BLAST search page for me
GGCAGTCTCAACAACCAAGGAGCTCAAGGAGCTCTCAAGAGCGCCGCAAAGTGGGCTACGAGTTCTTCAAGAGTCGAGTCATGCCTCCAAGATTGCGCAAGATTGCGCAACTGTTTTCTGTCAAGGAGGAACTTCTAGTCTGTACTTTTTAGATTTTAATGCTTTCGGCTCCGGGTACTTTGCTGCATTTCATTCCGTGTTCATTCCGTGTGTGCGCGAATCAAAAAACGGCTGATCTGAACGGAGACACTGCTGAACACATTTCCTGCATGCTATTCCTGCATGCTACCAAATTCTATTTTATCGTTACTTATTTGCACTACATGTATCCACAACAAACGGCAGTCTCA

Full Affymetrix probeset data:

Annotations for 1638735_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720