FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638736_at:

>probe:Drosophila_2:1638736_at:477:569; Interrogation_Position=14; Antisense; GGCATCAGTTACTTGGAAGTCACTA
>probe:Drosophila_2:1638736_at:695:563; Interrogation_Position=28; Antisense; GGAAGTCACTACCAGCTACGGATAT
>probe:Drosophila_2:1638736_at:525:439; Interrogation_Position=343; Antisense; GAGGCGGCGGCTGGTAAACACCAAA
>probe:Drosophila_2:1638736_at:383:491; Interrogation_Position=356; Antisense; GTAAACACCAAAGATCCCCAAGCGA
>probe:Drosophila_2:1638736_at:190:35; Interrogation_Position=381; Antisense; ATCACAGAAAACACTCCAGCAACCA
>probe:Drosophila_2:1638736_at:59:111; Interrogation_Position=398; Antisense; AGCAACCACCCGATACAAAATGATT
>probe:Drosophila_2:1638736_at:78:583; Interrogation_Position=427; Antisense; TGGCGACGTTGTCCTACTAAAAACA
>probe:Drosophila_2:1638736_at:78:661; Interrogation_Position=444; Antisense; TAAAAACAAAACCTGTCTCGCCTCT
>probe:Drosophila_2:1638736_at:83:317; Interrogation_Position=463; Antisense; GCCTCTTTTCCATTCTCAATTGTTT
>probe:Drosophila_2:1638736_at:555:543; Interrogation_Position=47; Antisense; GGATATCCAGTTCATCATGCGCTTC
>probe:Drosophila_2:1638736_at:184:443; Interrogation_Position=492; Antisense; GATGTGTTTTCATTACTTCCTTGTT
>probe:Drosophila_2:1638736_at:114:31; Interrogation_Position=527; Antisense; ATAAACCTATTTTCCTGCAATACAA
>probe:Drosophila_2:1638736_at:316:719; Interrogation_Position=79; Antisense; TTGCCGTTCTCCTCATCGGAGTGAT
>probe:Drosophila_2:1638736_at:703:41; Interrogation_Position=93; Antisense; ATCGGAGTGATCTTTGCCTTTGTTT

Paste this into a BLAST search page for me
GGCATCAGTTACTTGGAAGTCACTAGGAAGTCACTACCAGCTACGGATATGAGGCGGCGGCTGGTAAACACCAAAGTAAACACCAAAGATCCCCAAGCGAATCACAGAAAACACTCCAGCAACCAAGCAACCACCCGATACAAAATGATTTGGCGACGTTGTCCTACTAAAAACATAAAAACAAAACCTGTCTCGCCTCTGCCTCTTTTCCATTCTCAATTGTTTGGATATCCAGTTCATCATGCGCTTCGATGTGTTTTCATTACTTCCTTGTTATAAACCTATTTTCCTGCAATACAATTGCCGTTCTCCTCATCGGAGTGATATCGGAGTGATCTTTGCCTTTGTTT

Full Affymetrix probeset data:

Annotations for 1638736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720