Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638737_at:

>probe:Drosophila_2:1638737_at:330:165; Interrogation_Position=3591; Antisense; AAATCTATCAGACGCTGGGCATCGA
>probe:Drosophila_2:1638737_at:593:207; Interrogation_Position=3615; Antisense; AAGCTGCCCGAACCATCATTATGAG
>probe:Drosophila_2:1638737_at:143:485; Interrogation_Position=3669; Antisense; GTATGAGCGTCGATTGGCGCCACAT
>probe:Drosophila_2:1638737_at:632:603; Interrogation_Position=3732; Antisense; TGTTGGGTATCACGCGACACGGCTT
>probe:Drosophila_2:1638737_at:546:433; Interrogation_Position=3772; Antisense; GAGTGTCTTCAATTTGGCATCGTTT
>probe:Drosophila_2:1638737_at:139:289; Interrogation_Position=3807; Antisense; CGGACCACTTGTTTGATGCAGCTTA
>probe:Drosophila_2:1638737_at:473:617; Interrogation_Position=3823; Antisense; TGCAGCTTACTATGGCCAGACGGAT
>probe:Drosophila_2:1638737_at:58:273; Interrogation_Position=3850; Antisense; CATCAATGGCGTTTCGGAGCGCATT
>probe:Drosophila_2:1638737_at:645:683; Interrogation_Position=3874; Antisense; TATCCTGGGAATGCCAGCGTGCATT
>probe:Drosophila_2:1638737_at:42:509; Interrogation_Position=3892; Antisense; GTGCATTGGCACTGGCATCTTCAAG
>probe:Drosophila_2:1638737_at:104:139; Interrogation_Position=3930; Antisense; ACGAGGACAAGCAGGTGCCACCTAT
>probe:Drosophila_2:1638737_at:705:469; Interrogation_Position=3972; Antisense; GTTCCCTGAATCTGTTGCCAAGCAA
>probe:Drosophila_2:1638737_at:245:357; Interrogation_Position=4007; Antisense; GAAGCGGGCCTTCTTGACGTTATAC
>probe:Drosophila_2:1638737_at:668:129; Interrogation_Position=4103; Antisense; ACCTAGATTGTACTTAGCTGCGGAA

Paste this into a BLAST search page for me
AAATCTATCAGACGCTGGGCATCGAAAGCTGCCCGAACCATCATTATGAGGTATGAGCGTCGATTGGCGCCACATTGTTGGGTATCACGCGACACGGCTTGAGTGTCTTCAATTTGGCATCGTTTCGGACCACTTGTTTGATGCAGCTTATGCAGCTTACTATGGCCAGACGGATCATCAATGGCGTTTCGGAGCGCATTTATCCTGGGAATGCCAGCGTGCATTGTGCATTGGCACTGGCATCTTCAAGACGAGGACAAGCAGGTGCCACCTATGTTCCCTGAATCTGTTGCCAAGCAAGAAGCGGGCCTTCTTGACGTTATACACCTAGATTGTACTTAGCTGCGGAA

Full Affymetrix probeset data:

Annotations for 1638737_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime