Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638739_at:

>probe:Drosophila_2:1638739_at:322:259; Interrogation_Position=1027; Antisense; CACTGTTATTGTTGGCTCTGCATGC
>probe:Drosophila_2:1638739_at:293:623; Interrogation_Position=1049; Antisense; TGCGGATGTCCAAGAGCGGTGCTAC
>probe:Drosophila_2:1638739_at:332:211; Interrogation_Position=1075; Antisense; AAGAGCTACAAGACCTTCCCGAGGA
>probe:Drosophila_2:1638739_at:175:479; Interrogation_Position=1124; Antisense; GTTTAACGAACTGATCCACTTGGAG
>probe:Drosophila_2:1638739_at:44:651; Interrogation_Position=1182; Antisense; TCAGCTCCGATCATTGGCCGAACGT
>probe:Drosophila_2:1638739_at:513:367; Interrogation_Position=1226; Antisense; GAATGGCTTAGTCCTACCCAAGAAT
>probe:Drosophila_2:1638739_at:201:369; Interrogation_Position=1247; Antisense; GAATGCCCAGATTAGCATCCACATA
>probe:Drosophila_2:1638739_at:560:57; Interrogation_Position=1281; Antisense; ATGAGAGACGCACGGCATTTCCCGA
>probe:Drosophila_2:1638739_at:357:245; Interrogation_Position=1309; Antisense; CAAATCAATTCCTGCCCGAACGTTT
>probe:Drosophila_2:1638739_at:686:701; Interrogation_Position=1331; Antisense; TTTTCTGCCCGAGAACTCTGTGAAT
>probe:Drosophila_2:1638739_at:341:625; Interrogation_Position=1375; Antisense; TGCCCTTCAGTGCAGGCCCAAGGAA
>probe:Drosophila_2:1638739_at:235:79; Interrogation_Position=1406; Antisense; AGGTCAGAAATTCGGCGTCCTGGAA
>probe:Drosophila_2:1638739_at:153:395; Interrogation_Position=1428; Antisense; GAAATTAAGGTGCTCCTAGCCGCTG
>probe:Drosophila_2:1638739_at:213:197; Interrogation_Position=1509; Antisense; AACGGAATCGTACTGCGCACTCAGC

Paste this into a BLAST search page for me
CACTGTTATTGTTGGCTCTGCATGCTGCGGATGTCCAAGAGCGGTGCTACAAGAGCTACAAGACCTTCCCGAGGAGTTTAACGAACTGATCCACTTGGAGTCAGCTCCGATCATTGGCCGAACGTGAATGGCTTAGTCCTACCCAAGAATGAATGCCCAGATTAGCATCCACATAATGAGAGACGCACGGCATTTCCCGACAAATCAATTCCTGCCCGAACGTTTTTTTCTGCCCGAGAACTCTGTGAATTGCCCTTCAGTGCAGGCCCAAGGAAAGGTCAGAAATTCGGCGTCCTGGAAGAAATTAAGGTGCTCCTAGCCGCTGAACGGAATCGTACTGCGCACTCAGC

Full Affymetrix probeset data:

Annotations for 1638739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime