FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638742_at:

>probe:Drosophila_2:1638742_at:446:203; Interrogation_Position=112; Antisense; AAGCCGGATGGCTCATACAGCTGGG
>probe:Drosophila_2:1638742_at:34:27; Interrogation_Position=138; Antisense; ATACGGAACGTCCAACGGCATCGAT
>probe:Drosophila_2:1638742_at:315:33; Interrogation_Position=16; Antisense; ATCAAGACCGCGCTAATCATTTCCC
>probe:Drosophila_2:1638742_at:146:549; Interrogation_Position=184; Antisense; GGAGTCCAAGCTGCCGGATCCGTGA
>probe:Drosophila_2:1638742_at:309:413; Interrogation_Position=207; Antisense; GAGCTACGCTGCTCCCGATGGAACA
>probe:Drosophila_2:1638742_at:372:629; Interrogation_Position=236; Antisense; TCCAGCTGGAGTACACTGCCGATGA
>probe:Drosophila_2:1638742_at:547:383; Interrogation_Position=261; Antisense; GAACGGATATCGTCCTACTGGTGCT
>probe:Drosophila_2:1638742_at:257:655; Interrogation_Position=29; Antisense; TAATCATTTCCCTGTTCCTGGTGGC
>probe:Drosophila_2:1638742_at:525:9; Interrogation_Position=307; Antisense; ATTCCTGATTACATCCTCAAGGCTT
>probe:Drosophila_2:1638742_at:158:225; Interrogation_Position=325; Antisense; AAGGCTTTGGCCTACATCGAAGCGC
>probe:Drosophila_2:1638742_at:13:45; Interrogation_Position=340; Antisense; ATCGAAGCGCATCCATTCCAGAGGA
>probe:Drosophila_2:1638742_at:621:45; Interrogation_Position=58; Antisense; ATCCGGGCTGCAGACGAATCTCAGG
>probe:Drosophila_2:1638742_at:707:365; Interrogation_Position=73; Antisense; GAATCTCAGGCCGAGACCACCAAGT
>probe:Drosophila_2:1638742_at:538:127; Interrogation_Position=91; Antisense; ACCAAGTACCGCAACGAGATCAAGC

Paste this into a BLAST search page for me
AAGCCGGATGGCTCATACAGCTGGGATACGGAACGTCCAACGGCATCGATATCAAGACCGCGCTAATCATTTCCCGGAGTCCAAGCTGCCGGATCCGTGAGAGCTACGCTGCTCCCGATGGAACATCCAGCTGGAGTACACTGCCGATGAGAACGGATATCGTCCTACTGGTGCTTAATCATTTCCCTGTTCCTGGTGGCATTCCTGATTACATCCTCAAGGCTTAAGGCTTTGGCCTACATCGAAGCGCATCGAAGCGCATCCATTCCAGAGGAATCCGGGCTGCAGACGAATCTCAGGGAATCTCAGGCCGAGACCACCAAGTACCAAGTACCGCAACGAGATCAAGC

Full Affymetrix probeset data:

Annotations for 1638742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720