Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638744_at:

>probe:Drosophila_2:1638744_at:91:229; Interrogation_Position=205; Antisense; AATGGCATTGCCTCGGACGATTCGG
>probe:Drosophila_2:1638744_at:103:409; Interrogation_Position=220; Antisense; GACGATTCGGACGACGATGGCTATC
>probe:Drosophila_2:1638744_at:507:439; Interrogation_Position=235; Antisense; GATGGCTATCCGAAGAGGCGACCCA
>probe:Drosophila_2:1638744_at:229:99; Interrogation_Position=248; Antisense; AGAGGCGACCCAGCGTGATTGTCCA
>probe:Drosophila_2:1638744_at:469:365; Interrogation_Position=313; Antisense; GAATACATGACCTCAGCCTCCATAT
>probe:Drosophila_2:1638744_at:102:21; Interrogation_Position=334; Antisense; ATATTCCGGGATCATGCTCCACAGA
>probe:Drosophila_2:1638744_at:171:45; Interrogation_Position=366; Antisense; ATCGCAGTCGCAATCACATCATCTG
>probe:Drosophila_2:1638744_at:3:287; Interrogation_Position=395; Antisense; CTGGCAATGGTTTCATGGCCCGATT
>probe:Drosophila_2:1638744_at:239:7; Interrogation_Position=417; Antisense; ATTGAATAGCGTACGGCTGGCCAGC
>probe:Drosophila_2:1638744_at:693:185; Interrogation_Position=452; Antisense; AACAGCCACTTCTGGATTCCGGAGG
>probe:Drosophila_2:1638744_at:555:415; Interrogation_Position=551; Antisense; GAGCCAGCGCAACGCTCTGCAAGAA
>probe:Drosophila_2:1638744_at:600:359; Interrogation_Position=569; Antisense; GCAAGAACGCTGGACGGGCACTCAT
>probe:Drosophila_2:1638744_at:233:147; Interrogation_Position=588; Antisense; ACTCATCCGCATGATTTCATCGAGC
>probe:Drosophila_2:1638744_at:515:103; Interrogation_Position=630; Antisense; AGACGAATTCGATATCATGGGCAAG

Paste this into a BLAST search page for me
AATGGCATTGCCTCGGACGATTCGGGACGATTCGGACGACGATGGCTATCGATGGCTATCCGAAGAGGCGACCCAAGAGGCGACCCAGCGTGATTGTCCAGAATACATGACCTCAGCCTCCATATATATTCCGGGATCATGCTCCACAGAATCGCAGTCGCAATCACATCATCTGCTGGCAATGGTTTCATGGCCCGATTATTGAATAGCGTACGGCTGGCCAGCAACAGCCACTTCTGGATTCCGGAGGGAGCCAGCGCAACGCTCTGCAAGAAGCAAGAACGCTGGACGGGCACTCATACTCATCCGCATGATTTCATCGAGCAGACGAATTCGATATCATGGGCAAG

Full Affymetrix probeset data:

Annotations for 1638744_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime