Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638748_at:

>probe:Drosophila_2:1638748_at:190:631; Interrogation_Position=1892; Antisense; TCCTATTATTGATTAGCCACAGCCA
>probe:Drosophila_2:1638748_at:296:675; Interrogation_Position=1905; Antisense; TAGCCACAGCCAATAAACAACAAGA
>probe:Drosophila_2:1638748_at:551:107; Interrogation_Position=1927; Antisense; AGAACAACCAACTCAGCAGCACACA
>probe:Drosophila_2:1638748_at:117:353; Interrogation_Position=1942; Antisense; GCAGCACACACACATTCAAATTCAT
>probe:Drosophila_2:1638748_at:580:421; Interrogation_Position=2005; Antisense; GAGAAAGTTCATTTCCAGGCACTAA
>probe:Drosophila_2:1638748_at:630:267; Interrogation_Position=2020; Antisense; CAGGCACTAATTTTCACTCACACCA
>probe:Drosophila_2:1638748_at:59:617; Interrogation_Position=2069; Antisense; TCATTTTGTAGTTTTCCGAGTCCCT
>probe:Drosophila_2:1638748_at:637:411; Interrogation_Position=2086; Antisense; GAGTCCCTTGGATCGTTTTCCTCTT
>probe:Drosophila_2:1638748_at:132:603; Interrogation_Position=2188; Antisense; TGTTCTGTGATCTGTAGCATACTTT
>probe:Drosophila_2:1638748_at:599:327; Interrogation_Position=2242; Antisense; GCGATTTTAATTATGATCCGCAATC
>probe:Drosophila_2:1638748_at:663:449; Interrogation_Position=2256; Antisense; GATCCGCAATCGAAATTACACATTT
>probe:Drosophila_2:1638748_at:28:259; Interrogation_Position=2274; Antisense; CACATTTTTGTTCTCATTTCGATGG
>probe:Drosophila_2:1638748_at:86:441; Interrogation_Position=2294; Antisense; GATGGTAAAAACACTCTATCATGAT
>probe:Drosophila_2:1638748_at:696:385; Interrogation_Position=2386; Antisense; GAAAAACAAACACTAGCTCTTAATA

Paste this into a BLAST search page for me
TCCTATTATTGATTAGCCACAGCCATAGCCACAGCCAATAAACAACAAGAAGAACAACCAACTCAGCAGCACACAGCAGCACACACACATTCAAATTCATGAGAAAGTTCATTTCCAGGCACTAACAGGCACTAATTTTCACTCACACCATCATTTTGTAGTTTTCCGAGTCCCTGAGTCCCTTGGATCGTTTTCCTCTTTGTTCTGTGATCTGTAGCATACTTTGCGATTTTAATTATGATCCGCAATCGATCCGCAATCGAAATTACACATTTCACATTTTTGTTCTCATTTCGATGGGATGGTAAAAACACTCTATCATGATGAAAAACAAACACTAGCTCTTAATA

Full Affymetrix probeset data:

Annotations for 1638748_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime