FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638750_at:

>probe:Drosophila_2:1638750_at:593:427; Interrogation_Position=106; Antisense; GAGATTACGAGGGATCCGCCGCAAT
>probe:Drosophila_2:1638750_at:57:361; Interrogation_Position=126; Antisense; GCAATACTGCAGTGCTGGTCCGAAG
>probe:Drosophila_2:1638750_at:367:561; Interrogation_Position=15; Antisense; GGAAGGGCTATTTTCTGCCGAGGAT
>probe:Drosophila_2:1638750_at:715:433; Interrogation_Position=166; Antisense; GAGTGGACCTCGACGATCATCGGAC
>probe:Drosophila_2:1638750_at:541:557; Interrogation_Position=228; Antisense; GGACATATTCTTTCCGGTTGAGTAT
>probe:Drosophila_2:1638750_at:279:607; Interrogation_Position=246; Antisense; TGAGTATCCTTTTGCTCCACCGGTA
>probe:Drosophila_2:1638750_at:261:253; Interrogation_Position=262; Antisense; CCACCGGTAGTTATATTTCGCACGC
>probe:Drosophila_2:1638750_at:30:525; Interrogation_Position=315; Antisense; GGGCTTCATTTGTCTGGATATCCTG
>probe:Drosophila_2:1638750_at:39:567; Interrogation_Position=357; Antisense; GGCACTGACCATCTCGAAGATTCTG
>probe:Drosophila_2:1638750_at:415:441; Interrogation_Position=37; Antisense; GATGGCACACCTTCGTGCAGCTGGA
>probe:Drosophila_2:1638750_at:532:215; Interrogation_Position=373; Antisense; AAGATTCTGCTATCAATTTGCTCCC
>probe:Drosophila_2:1638750_at:654:545; Interrogation_Position=420; Antisense; GGATCCGCTGATGGCCAAAATTGGC
>probe:Drosophila_2:1638750_at:564:269; Interrogation_Position=472; Antisense; CATGACAAGAAAGCGCGCCTCTGGA
>probe:Drosophila_2:1638750_at:686:557; Interrogation_Position=59; Antisense; GGACATGCAGCAACAGCGCGGTTAA

Paste this into a BLAST search page for me
GAGATTACGAGGGATCCGCCGCAATGCAATACTGCAGTGCTGGTCCGAAGGGAAGGGCTATTTTCTGCCGAGGATGAGTGGACCTCGACGATCATCGGACGGACATATTCTTTCCGGTTGAGTATTGAGTATCCTTTTGCTCCACCGGTACCACCGGTAGTTATATTTCGCACGCGGGCTTCATTTGTCTGGATATCCTGGGCACTGACCATCTCGAAGATTCTGGATGGCACACCTTCGTGCAGCTGGAAAGATTCTGCTATCAATTTGCTCCCGGATCCGCTGATGGCCAAAATTGGCCATGACAAGAAAGCGCGCCTCTGGAGGACATGCAGCAACAGCGCGGTTAA

Full Affymetrix probeset data:

Annotations for 1638750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720