Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638753_at:

>probe:Drosophila_2:1638753_at:46:429; Interrogation_Position=1454; Antisense; GAGATATTGTTGTTGCTGGCCACGG
>probe:Drosophila_2:1638753_at:692:287; Interrogation_Position=1469; Antisense; CTGGCCACGGCAACGGACTGATATT
>probe:Drosophila_2:1638753_at:356:163; Interrogation_Position=1592; Antisense; AAATTCAACGAAGTGCGCAACCTGA
>probe:Drosophila_2:1638753_at:558:357; Interrogation_Position=1608; Antisense; GCAACCTGAAAAGTCCGCACTCAAA
>probe:Drosophila_2:1638753_at:177:327; Interrogation_Position=1624; Antisense; GCACTCAAACAATACGGTTCCTCAC
>probe:Drosophila_2:1638753_at:153:471; Interrogation_Position=1640; Antisense; GTTCCTCACTCCAATTCAATTCAAA
>probe:Drosophila_2:1638753_at:200:55; Interrogation_Position=1679; Antisense; ATGAAACTCACTTTTCCCACTATAC
>probe:Drosophila_2:1638753_at:674:297; Interrogation_Position=1694; Antisense; CCCACTATACTCGAATGTCAGGCAG
>probe:Drosophila_2:1638753_at:189:413; Interrogation_Position=1731; Antisense; GAGCCACGTTCGATCCGAGATGGAC
>probe:Drosophila_2:1638753_at:338:285; Interrogation_Position=1741; Antisense; CGATCCGAGATGGACATGGTTCCCC
>probe:Drosophila_2:1638753_at:647:297; Interrogation_Position=1770; Antisense; CGCTGGGCACACACATTGCTATGTA
>probe:Drosophila_2:1638753_at:93:273; Interrogation_Position=1783; Antisense; CATTGCTATGTACTACCACTACCTA
>probe:Drosophila_2:1638753_at:360:277; Interrogation_Position=1872; Antisense; CTACGAAATTCCTACAGTCTCCTAA
>probe:Drosophila_2:1638753_at:286:723; Interrogation_Position=1943; Antisense; TTGCATGACTCAACCAATACGATTG

Paste this into a BLAST search page for me
GAGATATTGTTGTTGCTGGCCACGGCTGGCCACGGCAACGGACTGATATTAAATTCAACGAAGTGCGCAACCTGAGCAACCTGAAAAGTCCGCACTCAAAGCACTCAAACAATACGGTTCCTCACGTTCCTCACTCCAATTCAATTCAAAATGAAACTCACTTTTCCCACTATACCCCACTATACTCGAATGTCAGGCAGGAGCCACGTTCGATCCGAGATGGACCGATCCGAGATGGACATGGTTCCCCCGCTGGGCACACACATTGCTATGTACATTGCTATGTACTACCACTACCTACTACGAAATTCCTACAGTCTCCTAATTGCATGACTCAACCAATACGATTG

Full Affymetrix probeset data:

Annotations for 1638753_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime