FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638758_at:

>probe:Drosophila_2:1638758_at:143:147; Interrogation_Position=1904; Antisense; ACTTTGTAACCTACAGGCGTGGCTC
>probe:Drosophila_2:1638758_at:196:719; Interrogation_Position=1930; Antisense; TTGCGGAACGCACATCGGTGGTACT
>probe:Drosophila_2:1638758_at:463:699; Interrogation_Position=2019; Antisense; TTTATTCTACGATCGTGGCCAGCAG
>probe:Drosophila_2:1638758_at:76:679; Interrogation_Position=2062; Antisense; TAGTCAGGTGTAGGTCGTCGGTATT
>probe:Drosophila_2:1638758_at:217:501; Interrogation_Position=2075; Antisense; GTCGTCGGTATTATTCTAGTCCATA
>probe:Drosophila_2:1638758_at:25:693; Interrogation_Position=2140; Antisense; TTTCGTCGAACGGTGGCCATAGCAA
>probe:Drosophila_2:1638758_at:24:487; Interrogation_Position=2209; Antisense; GTACGGGAACCCACGATGATCTGAC
>probe:Drosophila_2:1638758_at:618:443; Interrogation_Position=2223; Antisense; GATGATCTGACCTATACTCGGCGGG
>probe:Drosophila_2:1638758_at:256:531; Interrogation_Position=2245; Antisense; GGGTTCATGTAATGGTCTCCGCATA
>probe:Drosophila_2:1638758_at:375:641; Interrogation_Position=2260; Antisense; TCTCCGCATAATCCAAACTCTGTGT
>probe:Drosophila_2:1638758_at:160:179; Interrogation_Position=2274; Antisense; AAACTCTGTGTACGGCTTATTGCAT
>probe:Drosophila_2:1638758_at:232:419; Interrogation_Position=2323; Antisense; GAGCTCGACTCTTCATTTGTTATCT
>probe:Drosophila_2:1638758_at:293:163; Interrogation_Position=2375; Antisense; AAATTCATGCCGTGCTTTTAGCTGT
>probe:Drosophila_2:1638758_at:13:725; Interrogation_Position=2437; Antisense; TTGTTTGCGCGTTAATTCTGTAGGA

Paste this into a BLAST search page for me
ACTTTGTAACCTACAGGCGTGGCTCTTGCGGAACGCACATCGGTGGTACTTTTATTCTACGATCGTGGCCAGCAGTAGTCAGGTGTAGGTCGTCGGTATTGTCGTCGGTATTATTCTAGTCCATATTTCGTCGAACGGTGGCCATAGCAAGTACGGGAACCCACGATGATCTGACGATGATCTGACCTATACTCGGCGGGGGGTTCATGTAATGGTCTCCGCATATCTCCGCATAATCCAAACTCTGTGTAAACTCTGTGTACGGCTTATTGCATGAGCTCGACTCTTCATTTGTTATCTAAATTCATGCCGTGCTTTTAGCTGTTTGTTTGCGCGTTAATTCTGTAGGA

Full Affymetrix probeset data:

Annotations for 1638758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720