FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638759_at:

>probe:Drosophila_2:1638759_at:535:461; Interrogation_Position=103; Antisense; GATTACGAGTACAACAAGCATGTCT
>probe:Drosophila_2:1638759_at:396:159; Interrogation_Position=116; Antisense; ACAAGCATGTCTACGAGGAGAGAAC
>probe:Drosophila_2:1638759_at:92:381; Interrogation_Position=137; Antisense; GAACGAGGCGACAGGCAAAATTTGG
>probe:Drosophila_2:1638759_at:515:591; Interrogation_Position=169; Antisense; TGGGTTTGTCCATAATCGTTGCATC
>probe:Drosophila_2:1638759_at:235:31; Interrogation_Position=180; Antisense; ATAATCGTTGCATCGAACCCTCGGA
>probe:Drosophila_2:1638759_at:269:607; Interrogation_Position=188; Antisense; TGCATCGAACCCTCGGATAATCCGG
>probe:Drosophila_2:1638759_at:274:243; Interrogation_Position=19; Antisense; AATTATAATCCGAATTGCGGTTACT
>probe:Drosophila_2:1638759_at:273:381; Interrogation_Position=194; Antisense; GAACCCTCGGATAATCCGGGATAAT
>probe:Drosophila_2:1638759_at:490:363; Interrogation_Position=30; Antisense; GAATTGCGGTTACTTCGAGGATTGC
>probe:Drosophila_2:1638759_at:479:471; Interrogation_Position=38; Antisense; GTTACTTCGAGGATTGCAGCTACTA
>probe:Drosophila_2:1638759_at:730:541; Interrogation_Position=48; Antisense; GGATTGCAGCTACTACACGAACAAC
>probe:Drosophila_2:1638759_at:407:157; Interrogation_Position=63; Antisense; CACGAACAACGTGTTTCAACAGGAT
>probe:Drosophila_2:1638759_at:167:479; Interrogation_Position=75; Antisense; GTTTCAACAGGATTATTGCATGCAG
>probe:Drosophila_2:1638759_at:456:701; Interrogation_Position=87; Antisense; TTATTGCATGCAGACGGATTACGAG

Paste this into a BLAST search page for me
GATTACGAGTACAACAAGCATGTCTACAAGCATGTCTACGAGGAGAGAACGAACGAGGCGACAGGCAAAATTTGGTGGGTTTGTCCATAATCGTTGCATCATAATCGTTGCATCGAACCCTCGGATGCATCGAACCCTCGGATAATCCGGAATTATAATCCGAATTGCGGTTACTGAACCCTCGGATAATCCGGGATAATGAATTGCGGTTACTTCGAGGATTGCGTTACTTCGAGGATTGCAGCTACTAGGATTGCAGCTACTACACGAACAACCACGAACAACGTGTTTCAACAGGATGTTTCAACAGGATTATTGCATGCAGTTATTGCATGCAGACGGATTACGAG

Full Affymetrix probeset data:

Annotations for 1638759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720