Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638760_at:

>probe:Drosophila_2:1638760_at:282:587; Interrogation_Position=1008; Antisense; TGGAGATCTTAACCGACCACCCAAG
>probe:Drosophila_2:1638760_at:176:559; Interrogation_Position=1052; Antisense; GGAAATACCGATCCACAGCACTGGT
>probe:Drosophila_2:1638760_at:556:441; Interrogation_Position=532; Antisense; GATGTTGGACCTCCTCCGAAAAGAT
>probe:Drosophila_2:1638760_at:186:221; Interrogation_Position=559; Antisense; AAGTGGACCCCAGTGCAATACGAAT
>probe:Drosophila_2:1638760_at:715:315; Interrogation_Position=631; Antisense; GCCTCCAGCAGCAACTCATATAGTG
>probe:Drosophila_2:1638760_at:86:479; Interrogation_Position=655; Antisense; GTTTATGAGCCCGAACACGATGACT
>probe:Drosophila_2:1638760_at:11:139; Interrogation_Position=671; Antisense; ACGATGACTACGAGGTGGTTCCAGT
>probe:Drosophila_2:1638760_at:587:173; Interrogation_Position=725; Antisense; AAAGCGTCGCCTCCAAGAAACAAGT
>probe:Drosophila_2:1638760_at:714:439; Interrogation_Position=751; Antisense; GAGGCCTACCTAGAGGATCAGCAGA
>probe:Drosophila_2:1638760_at:585:409; Interrogation_Position=784; Antisense; GACGAGGCCATCAAAGTTCAGCTTT
>probe:Drosophila_2:1638760_at:203:181; Interrogation_Position=827; Antisense; AAAAATTCTTCAAGGCCCAGGCGCA
>probe:Drosophila_2:1638760_at:129:527; Interrogation_Position=863; Antisense; GGGAATCGCGGCCAGACCTCGAAAT
>probe:Drosophila_2:1638760_at:674:557; Interrogation_Position=928; Antisense; GGACACCTGCGCAACAAGTACATCG
>probe:Drosophila_2:1638760_at:189:371; Interrogation_Position=975; Antisense; GAAGGGATCTCGATCACGCCGGCGT

Paste this into a BLAST search page for me
TGGAGATCTTAACCGACCACCCAAGGGAAATACCGATCCACAGCACTGGTGATGTTGGACCTCCTCCGAAAAGATAAGTGGACCCCAGTGCAATACGAATGCCTCCAGCAGCAACTCATATAGTGGTTTATGAGCCCGAACACGATGACTACGATGACTACGAGGTGGTTCCAGTAAAGCGTCGCCTCCAAGAAACAAGTGAGGCCTACCTAGAGGATCAGCAGAGACGAGGCCATCAAAGTTCAGCTTTAAAAATTCTTCAAGGCCCAGGCGCAGGGAATCGCGGCCAGACCTCGAAATGGACACCTGCGCAACAAGTACATCGGAAGGGATCTCGATCACGCCGGCGT

Full Affymetrix probeset data:

Annotations for 1638760_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime