FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638762_at:

>probe:Drosophila_2:1638762_at:554:219; Interrogation_Position=222; Antisense; AAGTGTACTATTGCATCACCTGGCG
>probe:Drosophila_2:1638762_at:361:645; Interrogation_Position=237; Antisense; TCACCTGGCGGTTCCACAACTAAAG
>probe:Drosophila_2:1638762_at:465:145; Interrogation_Position=252; Antisense; ACAACTAAAGGTCTGCGTCTTCGGG
>probe:Drosophila_2:1638762_at:73:649; Interrogation_Position=279; Antisense; TCAGGAGCACTGTTATAAGGCCAAA
>probe:Drosophila_2:1638762_at:691:503; Interrogation_Position=378; Antisense; GTCCAAAGCTTACGATGTCTTCCTG
>probe:Drosophila_2:1638762_at:183:717; Interrogation_Position=397; Antisense; TTCCTGGCCTCCGAATCGATAATTA
>probe:Drosophila_2:1638762_at:302:47; Interrogation_Position=458; Antisense; ATGCGGGCAAATTTCTTACTCCTTT
>probe:Drosophila_2:1638762_at:251:707; Interrogation_Position=473; Antisense; TTACTCCTTTGGCTCGTGGCGAATC
>probe:Drosophila_2:1638762_at:1:497; Interrogation_Position=557; Antisense; GTCTTTCCGTTAATGTTGGCCATGT
>probe:Drosophila_2:1638762_at:182:59; Interrogation_Position=578; Antisense; ATGTTGGCATGCACCCAGAGGAACT
>probe:Drosophila_2:1638762_at:42:455; Interrogation_Position=624; Antisense; GATCAACTTTTTAGTGTCCTTGCTG
>probe:Drosophila_2:1638762_at:499:351; Interrogation_Position=660; Antisense; GCAGAATGTGCGCTCACTTCATATA
>probe:Drosophila_2:1638762_at:27:185; Interrogation_Position=684; Antisense; AAAATCATCGTTGGGCGTACCTCAT
>probe:Drosophila_2:1638762_at:12:329; Interrogation_Position=698; Antisense; GCGTACCTCATCAGCTCTATTGAAA

Paste this into a BLAST search page for me
AAGTGTACTATTGCATCACCTGGCGTCACCTGGCGGTTCCACAACTAAAGACAACTAAAGGTCTGCGTCTTCGGGTCAGGAGCACTGTTATAAGGCCAAAGTCCAAAGCTTACGATGTCTTCCTGTTCCTGGCCTCCGAATCGATAATTAATGCGGGCAAATTTCTTACTCCTTTTTACTCCTTTGGCTCGTGGCGAATCGTCTTTCCGTTAATGTTGGCCATGTATGTTGGCATGCACCCAGAGGAACTGATCAACTTTTTAGTGTCCTTGCTGGCAGAATGTGCGCTCACTTCATATAAAAATCATCGTTGGGCGTACCTCATGCGTACCTCATCAGCTCTATTGAAA

Full Affymetrix probeset data:

Annotations for 1638762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720