FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638764_at:

>probe:Drosophila_2:1638764_at:265:437; Interrogation_Position=127; Antisense; GAGGCTCCTCCGTCGTACGATGTGG
>probe:Drosophila_2:1638764_at:708:631; Interrogation_Position=135; Antisense; TCCGTCGTACGATGTGGCGGTGTCT
>probe:Drosophila_2:1638764_at:434:589; Interrogation_Position=14; Antisense; TGGATCAGAAGCGAGCCATGCTTTA
>probe:Drosophila_2:1638764_at:133:331; Interrogation_Position=151; Antisense; GCGGTGTCTGTTCCGGTGGCTCCAG
>probe:Drosophila_2:1638764_at:307:413; Interrogation_Position=206; Antisense; GACCACCGCCAGTGGTTGTCGTGGA
>probe:Drosophila_2:1638764_at:375:379; Interrogation_Position=21; Antisense; GAAGCGAGCCATGCTTTATCCGCAA
>probe:Drosophila_2:1638764_at:607:727; Interrogation_Position=221; Antisense; TTGTCGTGGAGCAGCCAGCCCCACA
>probe:Drosophila_2:1638764_at:372:133; Interrogation_Position=249; Antisense; ACCCACAGTGGTTCCAACAGGTGTG
>probe:Drosophila_2:1638764_at:133:259; Interrogation_Position=252; Antisense; CACAGTGGTTCCAACAGGTGTGTAG
>probe:Drosophila_2:1638764_at:645:415; Interrogation_Position=26; Antisense; GAGCCATGCTTTATCCGCAAGTGGA
>probe:Drosophila_2:1638764_at:20:683; Interrogation_Position=37; Antisense; TATCCGCAAGTGGATTTCAACGCCC
>probe:Drosophila_2:1638764_at:355:251; Interrogation_Position=43; Antisense; CAAGTGGATTTCAACGCCCCGACGG
>probe:Drosophila_2:1638764_at:192:283; Interrogation_Position=72; Antisense; CTCGCCGACGCCAACGAGGGAGTTG
>probe:Drosophila_2:1638764_at:529:305; Interrogation_Position=81; Antisense; GCCAACGAGGGAGTTGGGCAATCCC

Paste this into a BLAST search page for me
GAGGCTCCTCCGTCGTACGATGTGGTCCGTCGTACGATGTGGCGGTGTCTTGGATCAGAAGCGAGCCATGCTTTAGCGGTGTCTGTTCCGGTGGCTCCAGGACCACCGCCAGTGGTTGTCGTGGAGAAGCGAGCCATGCTTTATCCGCAATTGTCGTGGAGCAGCCAGCCCCACAACCCACAGTGGTTCCAACAGGTGTGCACAGTGGTTCCAACAGGTGTGTAGGAGCCATGCTTTATCCGCAAGTGGATATCCGCAAGTGGATTTCAACGCCCCAAGTGGATTTCAACGCCCCGACGGCTCGCCGACGCCAACGAGGGAGTTGGCCAACGAGGGAGTTGGGCAATCCC

Full Affymetrix probeset data:

Annotations for 1638764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720