FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638765_at:

>probe:Drosophila_2:1638765_at:658:107; Interrogation_Position=1021; Antisense; AGAAGCCCATCGAGATCTTTCACAT
>probe:Drosophila_2:1638765_at:459:385; Interrogation_Position=1050; Antisense; GAACATTTCTGCTTGGGTCGACGGC
>probe:Drosophila_2:1638765_at:133:141; Interrogation_Position=1070; Antisense; ACGGCGTTTGCATCTGTTCGGCAGA
>probe:Drosophila_2:1638765_at:178:465; Interrogation_Position=1114; Antisense; GTTGGCTAACTGTTGGTCCGGAACT
>probe:Drosophila_2:1638765_at:83:27; Interrogation_Position=1166; Antisense; ATACCAGACCTACTTTGCTGAGGCT
>probe:Drosophila_2:1638765_at:726:125; Interrogation_Position=1193; Antisense; AGCCACCGGTTGCACTAGTAGGATT
>probe:Drosophila_2:1638765_at:60:79; Interrogation_Position=1212; Antisense; AGGATTGAACTACTGAGGCCCAAGA
>probe:Drosophila_2:1638765_at:545:87; Interrogation_Position=1236; Antisense; AGTCCGCCGCCGAATAGCAAAGTTT
>probe:Drosophila_2:1638765_at:96:101; Interrogation_Position=1269; Antisense; AGAGGACGCGGCTTTCCACGTGGTC
>probe:Drosophila_2:1638765_at:432:371; Interrogation_Position=1297; Antisense; GAAGGCCCAGATAACAGCATTTTTA
>probe:Drosophila_2:1638765_at:633:159; Interrogation_Position=1326; Antisense; ACAACTGCGTGTATTCTAGTGTCTA
>probe:Drosophila_2:1638765_at:628:553; Interrogation_Position=835; Antisense; GGACCAACATTAACAAGCCCGGGCA
>probe:Drosophila_2:1638765_at:148:393; Interrogation_Position=878; Antisense; GAAAGCGGTCTTTCAACGCACCAAG
>probe:Drosophila_2:1638765_at:554:575; Interrogation_Position=951; Antisense; GGCGATTTTATCCATGCCAACGTGG

Paste this into a BLAST search page for me
AGAAGCCCATCGAGATCTTTCACATGAACATTTCTGCTTGGGTCGACGGCACGGCGTTTGCATCTGTTCGGCAGAGTTGGCTAACTGTTGGTCCGGAACTATACCAGACCTACTTTGCTGAGGCTAGCCACCGGTTGCACTAGTAGGATTAGGATTGAACTACTGAGGCCCAAGAAGTCCGCCGCCGAATAGCAAAGTTTAGAGGACGCGGCTTTCCACGTGGTCGAAGGCCCAGATAACAGCATTTTTAACAACTGCGTGTATTCTAGTGTCTAGGACCAACATTAACAAGCCCGGGCAGAAAGCGGTCTTTCAACGCACCAAGGGCGATTTTATCCATGCCAACGTGG

Full Affymetrix probeset data:

Annotations for 1638765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720