FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638766_at:

>probe:Drosophila_2:1638766_at:15:67; Interrogation_Position=109; Antisense; ATGGAGCTCGGAGTCAGTGCCAGAC
>probe:Drosophila_2:1638766_at:29:87; Interrogation_Position=124; Antisense; AGTGCCAGACTAGGTAATGTTCCCA
>probe:Drosophila_2:1638766_at:718:389; Interrogation_Position=150; Antisense; GAAACAGGTTGTGGGTCCACCTCAG
>probe:Drosophila_2:1638766_at:65:519; Interrogation_Position=160; Antisense; GTGGGTCCACCTCAGCTCAGATCAG
>probe:Drosophila_2:1638766_at:713:69; Interrogation_Position=17; Antisense; AGGCCACAACTACTCATTTCCAAAC
>probe:Drosophila_2:1638766_at:421:251; Interrogation_Position=352; Antisense; CAAAGGCTATGTGCGAGCCGGGCCC
>probe:Drosophila_2:1638766_at:498:123; Interrogation_Position=367; Antisense; AGCCGGGCCCAGTCGAGTATATGGC
>probe:Drosophila_2:1638766_at:322:265; Interrogation_Position=376; Antisense; CAGTCGAGTATATGGCCATGGGCAA
>probe:Drosophila_2:1638766_at:295:225; Interrogation_Position=399; Antisense; AAGGCAATGCAAGCCGAGCGGAGTC
>probe:Drosophila_2:1638766_at:239:287; Interrogation_Position=417; Antisense; CGGAGTCAGGGCTGCCTCTGCCTCT
>probe:Drosophila_2:1638766_at:332:643; Interrogation_Position=433; Antisense; TCTGCCTCTGAACTGCATCTGAACT
>probe:Drosophila_2:1638766_at:432:635; Interrogation_Position=439; Antisense; TCTGAACTGCATCTGAACTGGCGGG
>probe:Drosophila_2:1638766_at:669:579; Interrogation_Position=580; Antisense; TGGCCTACACATCTGGTCAGAAAGC
>probe:Drosophila_2:1638766_at:262:267; Interrogation_Position=63; Antisense; CAGTGGTCAGCGCAATTCAGCCCGA

Paste this into a BLAST search page for me
ATGGAGCTCGGAGTCAGTGCCAGACAGTGCCAGACTAGGTAATGTTCCCAGAAACAGGTTGTGGGTCCACCTCAGGTGGGTCCACCTCAGCTCAGATCAGAGGCCACAACTACTCATTTCCAAACCAAAGGCTATGTGCGAGCCGGGCCCAGCCGGGCCCAGTCGAGTATATGGCCAGTCGAGTATATGGCCATGGGCAAAAGGCAATGCAAGCCGAGCGGAGTCCGGAGTCAGGGCTGCCTCTGCCTCTTCTGCCTCTGAACTGCATCTGAACTTCTGAACTGCATCTGAACTGGCGGGTGGCCTACACATCTGGTCAGAAAGCCAGTGGTCAGCGCAATTCAGCCCGA

Full Affymetrix probeset data:

Annotations for 1638766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720