FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638767_at:

>probe:Drosophila_2:1638767_at:343:303; Interrogation_Position=280; Antisense; CCGCAATCCCGAAAGGTGAGTAGCA
>probe:Drosophila_2:1638767_at:515:1; Interrogation_Position=285; Antisense; ATCCCGAAAGGTGAGTAGCAGTACT
>probe:Drosophila_2:1638767_at:53:535; Interrogation_Position=294; Antisense; GGTGAGTAGCAGTACTGCAATCCAA
>probe:Drosophila_2:1638767_at:448:89; Interrogation_Position=298; Antisense; AGTAGCAGTACTGCAATCCAACTGA
>probe:Drosophila_2:1638767_at:269:349; Interrogation_Position=302; Antisense; GCAGTACTGCAATCCAACTGACTGG
>probe:Drosophila_2:1638767_at:444:489; Interrogation_Position=305; Antisense; GTACTGCAATCCAACTGACTGGACG
>probe:Drosophila_2:1638767_at:531:615; Interrogation_Position=309; Antisense; TGCAATCCAACTGACTGGACGACCG
>probe:Drosophila_2:1638767_at:218:233; Interrogation_Position=312; Antisense; AATCCAACTGACTGGACGACCGCTG
>probe:Drosophila_2:1638767_at:300:195; Interrogation_Position=317; Antisense; AACTGACTGGACGACCGCTGAATGA
>probe:Drosophila_2:1638767_at:136:283; Interrogation_Position=319; Antisense; CTGACTGGACGACCGCTGAATGAGC
>probe:Drosophila_2:1638767_at:348:141; Interrogation_Position=322; Antisense; ACTGGACGACCGCTGAATGAGCTAT
>probe:Drosophila_2:1638767_at:122:557; Interrogation_Position=325; Antisense; GGACGACCGCTGAATGAGCTATCTC
>probe:Drosophila_2:1638767_at:73:137; Interrogation_Position=327; Antisense; ACGACCGCTGAATGAGCTATCTCCC
>probe:Drosophila_2:1638767_at:138:613; Interrogation_Position=335; Antisense; TGAATGAGCTATCTCCCCCACAGAA

Paste this into a BLAST search page for me
CCGCAATCCCGAAAGGTGAGTAGCAATCCCGAAAGGTGAGTAGCAGTACTGGTGAGTAGCAGTACTGCAATCCAAAGTAGCAGTACTGCAATCCAACTGAGCAGTACTGCAATCCAACTGACTGGGTACTGCAATCCAACTGACTGGACGTGCAATCCAACTGACTGGACGACCGAATCCAACTGACTGGACGACCGCTGAACTGACTGGACGACCGCTGAATGACTGACTGGACGACCGCTGAATGAGCACTGGACGACCGCTGAATGAGCTATGGACGACCGCTGAATGAGCTATCTCACGACCGCTGAATGAGCTATCTCCCTGAATGAGCTATCTCCCCCACAGAA

Full Affymetrix probeset data:

Annotations for 1638767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720