FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638768_at:

>probe:Drosophila_2:1638768_at:70:303; Interrogation_Position=1049; Antisense; CCCCAGCTGCAAGTATTTAGTTTTT
>probe:Drosophila_2:1638768_at:556:475; Interrogation_Position=1068; Antisense; GTTTTTAAGTGCAACTCCAACAGGC
>probe:Drosophila_2:1638768_at:700:509; Interrogation_Position=1076; Antisense; GTGCAACTCCAACAGGCAAATGAAG
>probe:Drosophila_2:1638768_at:328:427; Interrogation_Position=1100; Antisense; GAGTAAAACAGAGCTAGCGAAATTT
>probe:Drosophila_2:1638768_at:621:513; Interrogation_Position=1142; Antisense; GTGTTATACACGGAGCACAATTTTA
>probe:Drosophila_2:1638768_at:716:23; Interrogation_Position=1186; Antisense; ATATGTTATATATCTAGCCTACACA
>probe:Drosophila_2:1638768_at:295:675; Interrogation_Position=1200; Antisense; TAGCCTACACAAAAACACGCACACA
>probe:Drosophila_2:1638768_at:479:187; Interrogation_Position=1242; Antisense; AACACACACACAAATCCCGAGCAAA
>probe:Drosophila_2:1638768_at:720:629; Interrogation_Position=1256; Antisense; TCCCGAGCAAAGACACAAACGAATC
>probe:Drosophila_2:1638768_at:166:229; Interrogation_Position=863; Antisense; AATGGCTACGATTATCAGCCACCTC
>probe:Drosophila_2:1638768_at:121:583; Interrogation_Position=897; Antisense; TGGCGACGCCATCTCGTCTGTATCT
>probe:Drosophila_2:1638768_at:182:601; Interrogation_Position=915; Antisense; TGTATCTGCCCACCGCATAAGGCGA
>probe:Drosophila_2:1638768_at:159:323; Interrogation_Position=922; Antisense; GCCCACCGCATAAGGCGATTATTAT
>probe:Drosophila_2:1638768_at:687:705; Interrogation_Position=947; Antisense; TTAGATATACCCTTATCCAACACCC

Paste this into a BLAST search page for me
CCCCAGCTGCAAGTATTTAGTTTTTGTTTTTAAGTGCAACTCCAACAGGCGTGCAACTCCAACAGGCAAATGAAGGAGTAAAACAGAGCTAGCGAAATTTGTGTTATACACGGAGCACAATTTTAATATGTTATATATCTAGCCTACACATAGCCTACACAAAAACACGCACACAAACACACACACAAATCCCGAGCAAATCCCGAGCAAAGACACAAACGAATCAATGGCTACGATTATCAGCCACCTCTGGCGACGCCATCTCGTCTGTATCTTGTATCTGCCCACCGCATAAGGCGAGCCCACCGCATAAGGCGATTATTATTTAGATATACCCTTATCCAACACCC

Full Affymetrix probeset data:

Annotations for 1638768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720