Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638769_a_at:

>probe:Drosophila_2:1638769_a_at:126:197; Interrogation_Position=129; Antisense; AACGATGAGTTCTTGAAGGATCCCA
>probe:Drosophila_2:1638769_a_at:136:225; Interrogation_Position=144; Antisense; AAGGATCCCAGGACGCAGTGGCTGC
>probe:Drosophila_2:1638769_a_at:8:631; Interrogation_Position=169; Antisense; TCCATCAGCGGCGTCAAACCGAGGA
>probe:Drosophila_2:1638769_a_at:477:445; Interrogation_Position=210; Antisense; GATGCTAGGATCAGTCCGTTGGGCA
>probe:Drosophila_2:1638769_a_at:196:501; Interrogation_Position=253; Antisense; GTCGTCTGCTGGGTAGGTCCAAGAT
>probe:Drosophila_2:1638769_a_at:207:163; Interrogation_Position=26; Antisense; AAATTCGTCAGTAATCAGCAGGGTG
>probe:Drosophila_2:1638769_a_at:468:505; Interrogation_Position=269; Antisense; GTCCAAGATAAATCTGTCCCCGCAA
>probe:Drosophila_2:1638769_a_at:200:107; Interrogation_Position=301; Antisense; AGAACAATCTCGTCGTGACCCGGAC
>probe:Drosophila_2:1638769_a_at:71:307; Interrogation_Position=325; Antisense; CCTTTTGCCAAATCCTCCAAGTTGA
>probe:Drosophila_2:1638769_a_at:572:91; Interrogation_Position=344; Antisense; AGTTGAAAACTCCACACCCAGAAAG
>probe:Drosophila_2:1638769_a_at:348:173; Interrogation_Position=365; Antisense; AAAGCAGTCGGGACCAATGCCTGCT
>probe:Drosophila_2:1638769_a_at:235:227; Interrogation_Position=416; Antisense; AAGGCAGAGTCTCATCTTCAGCGCT
>probe:Drosophila_2:1638769_a_at:639:613; Interrogation_Position=49; Antisense; TGAACGCGGGATTGGCTCGCTGTTT
>probe:Drosophila_2:1638769_a_at:40:481; Interrogation_Position=70; Antisense; GTTTGAGCCACCATCGGCGATTGTG

Paste this into a BLAST search page for me
AACGATGAGTTCTTGAAGGATCCCAAAGGATCCCAGGACGCAGTGGCTGCTCCATCAGCGGCGTCAAACCGAGGAGATGCTAGGATCAGTCCGTTGGGCAGTCGTCTGCTGGGTAGGTCCAAGATAAATTCGTCAGTAATCAGCAGGGTGGTCCAAGATAAATCTGTCCCCGCAAAGAACAATCTCGTCGTGACCCGGACCCTTTTGCCAAATCCTCCAAGTTGAAGTTGAAAACTCCACACCCAGAAAGAAAGCAGTCGGGACCAATGCCTGCTAAGGCAGAGTCTCATCTTCAGCGCTTGAACGCGGGATTGGCTCGCTGTTTGTTTGAGCCACCATCGGCGATTGTG

Full Affymetrix probeset data:

Annotations for 1638769_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime