FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638772_at:

>probe:Drosophila_2:1638772_at:560:143; Interrogation_Position=106; Antisense; ACTGTCTTTGTGCTTGGTCTTCTGG
>probe:Drosophila_2:1638772_at:545:537; Interrogation_Position=121; Antisense; GGTCTTCTGGCTTTGGCCAATGCTA
>probe:Drosophila_2:1638772_at:637:691; Interrogation_Position=132; Antisense; TTTGGCCAATGCTATTCCGTTGTCA
>probe:Drosophila_2:1638772_at:117:233; Interrogation_Position=139; Antisense; AATGCTATTCCGTTGTCACCCGATC
>probe:Drosophila_2:1638772_at:7:263; Interrogation_Position=17; Antisense; CAGTTGTAGTTGATCGTTTGTCCGG
>probe:Drosophila_2:1638772_at:183:603; Interrogation_Position=171; Antisense; TGTTATCATCAATGGCGACTGTGTG
>probe:Drosophila_2:1638772_at:201:583; Interrogation_Position=183; Antisense; TGGCGACTGTGTGAATTGCAATGTT
>probe:Drosophila_2:1638772_at:19:361; Interrogation_Position=200; Antisense; GCAATGTTCGTGGTGGCAAATAGAA
>probe:Drosophila_2:1638772_at:3:679; Interrogation_Position=23; Antisense; TAGTTGATCGTTTGTCCGGTGTGTT
>probe:Drosophila_2:1638772_at:239:729; Interrogation_Position=34; Antisense; TTGTCCGGTGTGTTCAGCTTATAAA
>probe:Drosophila_2:1638772_at:115:473; Interrogation_Position=45; Antisense; GTTCAGCTTATAAAACCGGATCTAT
>probe:Drosophila_2:1638772_at:416:387; Interrogation_Position=75; Antisense; GAAAATCAATATGCGATTCTTTGCA
>probe:Drosophila_2:1638772_at:543:11; Interrogation_Position=90; Antisense; ATTCTTTGCAATCGTCACTGTCTTT
>probe:Drosophila_2:1638772_at:527:233; Interrogation_Position=99; Antisense; AATCGTCACTGTCTTTGTGCTTGGT

Paste this into a BLAST search page for me
ACTGTCTTTGTGCTTGGTCTTCTGGGGTCTTCTGGCTTTGGCCAATGCTATTTGGCCAATGCTATTCCGTTGTCAAATGCTATTCCGTTGTCACCCGATCCAGTTGTAGTTGATCGTTTGTCCGGTGTTATCATCAATGGCGACTGTGTGTGGCGACTGTGTGAATTGCAATGTTGCAATGTTCGTGGTGGCAAATAGAATAGTTGATCGTTTGTCCGGTGTGTTTTGTCCGGTGTGTTCAGCTTATAAAGTTCAGCTTATAAAACCGGATCTATGAAAATCAATATGCGATTCTTTGCAATTCTTTGCAATCGTCACTGTCTTTAATCGTCACTGTCTTTGTGCTTGGT

Full Affymetrix probeset data:

Annotations for 1638772_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720