FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638774_at:

>probe:Drosophila_2:1638774_at:242:211; Interrogation_Position=418; Antisense; AAGAAGCAGCGCCAGATCACGTTCC
>probe:Drosophila_2:1638774_at:624:61; Interrogation_Position=446; Antisense; ATGTGTTCCATCACGTCTTCATGGT
>probe:Drosophila_2:1638774_at:614:461; Interrogation_Position=494; Antisense; GATTCTACGGTTTTGGTGGCCATGT
>probe:Drosophila_2:1638774_at:591:61; Interrogation_Position=515; Antisense; ATGTCTTCCTGATCTGCATGTTCAA
>probe:Drosophila_2:1638774_at:550:59; Interrogation_Position=539; Antisense; ATGTTCTGGTGCACATCGTCATGTA
>probe:Drosophila_2:1638774_at:630:371; Interrogation_Position=618; Antisense; GAAGAAGTACCTTACCCTGGGCCAG
>probe:Drosophila_2:1638774_at:437:607; Interrogation_Position=659; Antisense; TGATGTTCCTGCACTGCATGTACAC
>probe:Drosophila_2:1638774_at:112:349; Interrogation_Position=674; Antisense; GCATGTACACCTATTTCCAGCCAAA
>probe:Drosophila_2:1638774_at:141:645; Interrogation_Position=722; Antisense; TCTATGTCATAAGTTCGGCCAGCGC
>probe:Drosophila_2:1638774_at:170:125; Interrogation_Position=742; Antisense; AGCGCCTTCATGTTTCTGATGTTCA
>probe:Drosophila_2:1638774_at:359:31; Interrogation_Position=778; Antisense; ATAAAGACCTACATTCGGCCGAAAG
>probe:Drosophila_2:1638774_at:376:369; Interrogation_Position=830; Antisense; GAATGCACCTGCTACACTGTGATCA
>probe:Drosophila_2:1638774_at:67:375; Interrogation_Position=901; Antisense; GAAGAGTGTCTTTCCAACTTTCATA
>probe:Drosophila_2:1638774_at:28:685; Interrogation_Position=936; Antisense; TATAAAATTCCCACCTTTGATCCTG

Paste this into a BLAST search page for me
AAGAAGCAGCGCCAGATCACGTTCCATGTGTTCCATCACGTCTTCATGGTGATTCTACGGTTTTGGTGGCCATGTATGTCTTCCTGATCTGCATGTTCAAATGTTCTGGTGCACATCGTCATGTAGAAGAAGTACCTTACCCTGGGCCAGTGATGTTCCTGCACTGCATGTACACGCATGTACACCTATTTCCAGCCAAATCTATGTCATAAGTTCGGCCAGCGCAGCGCCTTCATGTTTCTGATGTTCAATAAAGACCTACATTCGGCCGAAAGGAATGCACCTGCTACACTGTGATCAGAAGAGTGTCTTTCCAACTTTCATATATAAAATTCCCACCTTTGATCCTG

Full Affymetrix probeset data:

Annotations for 1638774_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720