FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638775_at:

>probe:Drosophila_2:1638775_at:104:61; Interrogation_Position=3347; Antisense; ATGTTTCTATGACCAATCTGCGCAA
>probe:Drosophila_2:1638775_at:445:199; Interrogation_Position=3370; Antisense; AACCAGTTGGGTATCGTGTCGCAGG
>probe:Drosophila_2:1638775_at:482:11; Interrogation_Position=3400; Antisense; ATTCTTTTCGATCGCACAATCCGAG
>probe:Drosophila_2:1638775_at:94:21; Interrogation_Position=3428; Antisense; ATATTTCCTACGGTGACAATGCCAG
>probe:Drosophila_2:1638775_at:725:75; Interrogation_Position=3467; Antisense; AGGAGATCATCTCGGCGTGCAAAAA
>probe:Drosophila_2:1638775_at:219:375; Interrogation_Position=3579; Antisense; GAAGCAGCGCATAGCTATTGCACGA
>probe:Drosophila_2:1638775_at:418:165; Interrogation_Position=3623; Antisense; AAATCATGCTGCTTGACGAGGCCAC
>probe:Drosophila_2:1638775_at:581:147; Interrogation_Position=3646; Antisense; ACTTCTGCCTTGGACGCTGAAAGTG
>probe:Drosophila_2:1638775_at:216:79; Interrogation_Position=3674; Antisense; AGGTTGTCCAAGATGCACTCGATGC
>probe:Drosophila_2:1638775_at:268:445; Interrogation_Position=3694; Antisense; GATGCCGCCTCTGAAGGACGTACCA
>probe:Drosophila_2:1638775_at:110:407; Interrogation_Position=3710; Antisense; GACGTACCACGATCAGTATAGCCCA
>probe:Drosophila_2:1638775_at:544:461; Interrogation_Position=3748; Antisense; GTTGTCCACTCCGACGTAATATTCG
>probe:Drosophila_2:1638775_at:178:531; Interrogation_Position=3831; Antisense; GGGTCTCTACTACACGCTGTACAAA
>probe:Drosophila_2:1638775_at:444:491; Interrogation_Position=3849; Antisense; GTACAAACTTCAGAGCGGAGCCATG

Paste this into a BLAST search page for me
ATGTTTCTATGACCAATCTGCGCAAAACCAGTTGGGTATCGTGTCGCAGGATTCTTTTCGATCGCACAATCCGAGATATTTCCTACGGTGACAATGCCAGAGGAGATCATCTCGGCGTGCAAAAAGAAGCAGCGCATAGCTATTGCACGAAAATCATGCTGCTTGACGAGGCCACACTTCTGCCTTGGACGCTGAAAGTGAGGTTGTCCAAGATGCACTCGATGCGATGCCGCCTCTGAAGGACGTACCAGACGTACCACGATCAGTATAGCCCAGTTGTCCACTCCGACGTAATATTCGGGGTCTCTACTACACGCTGTACAAAGTACAAACTTCAGAGCGGAGCCATG

Full Affymetrix probeset data:

Annotations for 1638775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720