FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638777_at:

>probe:Drosophila_2:1638777_at:521:113; Interrogation_Position=104; Antisense; AGCAGAATGAGATCATGCGGCGCAA
>probe:Drosophila_2:1638777_at:726:647; Interrogation_Position=116; Antisense; TCATGCGGCGCAAACAGGACGAGGT
>probe:Drosophila_2:1638777_at:310:519; Interrogation_Position=139; Antisense; GTGGTGACGCTGGAAATGCAAATCA
>probe:Drosophila_2:1638777_at:488:357; Interrogation_Position=156; Antisense; GCAAATCAGACAGCGATCCGAGCAG
>probe:Drosophila_2:1638777_at:332:121; Interrogation_Position=200; Antisense; AGCTGGATGCCACCTGTCACATATG
>probe:Drosophila_2:1638777_at:217:313; Interrogation_Position=208; Antisense; GCCACCTGTCACATATGCCTTAAGA
>probe:Drosophila_2:1638777_at:136:625; Interrogation_Position=223; Antisense; TGCCTTAAGACCAAGTTCGCCGATG
>probe:Drosophila_2:1638777_at:298:217; Interrogation_Position=235; Antisense; AAGTTCGCCGATGGAGTGGGCCACA
>probe:Drosophila_2:1638777_at:457:433; Interrogation_Position=248; Antisense; GAGTGGGCCACATCTGCCACTACTG
>probe:Drosophila_2:1638777_at:542:147; Interrogation_Position=266; Antisense; ACTACTGCAACATACGCTGCTGCGC
>probe:Drosophila_2:1638777_at:632:511; Interrogation_Position=307; Antisense; GTGACGCTTCGCAGCAACAAGGTGA
>probe:Drosophila_2:1638777_at:326:513; Interrogation_Position=328; Antisense; GTGAGAGTTGTACCCAATCCCATGC
>probe:Drosophila_2:1638777_at:661:649; Interrogation_Position=41; Antisense; TCACGCCCCACGAGCGGATGCAGAT
>probe:Drosophila_2:1638777_at:671:445; Interrogation_Position=57; Antisense; GATGCAGATCGAGAATGTCCTTATG

Paste this into a BLAST search page for me
AGCAGAATGAGATCATGCGGCGCAATCATGCGGCGCAAACAGGACGAGGTGTGGTGACGCTGGAAATGCAAATCAGCAAATCAGACAGCGATCCGAGCAGAGCTGGATGCCACCTGTCACATATGGCCACCTGTCACATATGCCTTAAGATGCCTTAAGACCAAGTTCGCCGATGAAGTTCGCCGATGGAGTGGGCCACAGAGTGGGCCACATCTGCCACTACTGACTACTGCAACATACGCTGCTGCGCGTGACGCTTCGCAGCAACAAGGTGAGTGAGAGTTGTACCCAATCCCATGCTCACGCCCCACGAGCGGATGCAGATGATGCAGATCGAGAATGTCCTTATG

Full Affymetrix probeset data:

Annotations for 1638777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720