FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638778_at:

>probe:Drosophila_2:1638778_at:26:661; Interrogation_Position=392; Antisense; TAAATGCCGGATTTCGTTTGGCCCA
>probe:Drosophila_2:1638778_at:169:615; Interrogation_Position=446; Antisense; TGAAGGATCTGCACGAGGCCATCTT
>probe:Drosophila_2:1638778_at:434:37; Interrogation_Position=466; Antisense; ATCTTCTCTGGCGAATCGGTGGATG
>probe:Drosophila_2:1638778_at:195:447; Interrogation_Position=487; Antisense; GATGCGGTCATCATCGACGTTGACT
>probe:Drosophila_2:1638778_at:132:253; Interrogation_Position=528; Antisense; CAAGTTGATGCGTGCCCATTTCCAG
>probe:Drosophila_2:1638778_at:303:667; Interrogation_Position=554; Antisense; TACAGAATCCGAAGTGCCTTTTCCT
>probe:Drosophila_2:1638778_at:560:551; Interrogation_Position=583; Antisense; GGAGCTGCCGATGCTTTGATTCCAT
>probe:Drosophila_2:1638778_at:431:415; Interrogation_Position=635; Antisense; GAGCCTTTATCGACGTGGTGACCCA
>probe:Drosophila_2:1638778_at:99:451; Interrogation_Position=703; Antisense; GATCTGCGCAAGCTTCTACTGGAAC
>probe:Drosophila_2:1638778_at:542:19; Interrogation_Position=785; Antisense; ATATTGGATTCGCTCGCGCCAGTGG
>probe:Drosophila_2:1638778_at:57:277; Interrogation_Position=829; Antisense; CTTACCGGCGGCACAAAGCTGGAGG
>probe:Drosophila_2:1638778_at:677:97; Interrogation_Position=884; Antisense; AGATGCCCGACTATCTGGCCGATTG
>probe:Drosophila_2:1638778_at:675:29; Interrogation_Position=932; Antisense; ATAATCCGGCATCGAGTAACTCTGA
>probe:Drosophila_2:1638778_at:313:491; Interrogation_Position=947; Antisense; GTAACTCTGACTCGGCGCATTCGGT

Paste this into a BLAST search page for me
TAAATGCCGGATTTCGTTTGGCCCATGAAGGATCTGCACGAGGCCATCTTATCTTCTCTGGCGAATCGGTGGATGGATGCGGTCATCATCGACGTTGACTCAAGTTGATGCGTGCCCATTTCCAGTACAGAATCCGAAGTGCCTTTTCCTGGAGCTGCCGATGCTTTGATTCCATGAGCCTTTATCGACGTGGTGACCCAGATCTGCGCAAGCTTCTACTGGAACATATTGGATTCGCTCGCGCCAGTGGCTTACCGGCGGCACAAAGCTGGAGGAGATGCCCGACTATCTGGCCGATTGATAATCCGGCATCGAGTAACTCTGAGTAACTCTGACTCGGCGCATTCGGT

Full Affymetrix probeset data:

Annotations for 1638778_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720