FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638779_at:

>probe:Drosophila_2:1638779_at:446:675; Interrogation_Position=1653; Antisense; TAGAAAAATTTGTCCGCCAGCGAAA
>probe:Drosophila_2:1638779_at:483:201; Interrogation_Position=1676; Antisense; AACCGGACTTTATTTCTCAACAGAT
>probe:Drosophila_2:1638779_at:665:251; Interrogation_Position=1725; Antisense; CAAGACAATGTTATGCAACCTGGCG
>probe:Drosophila_2:1638779_at:44:361; Interrogation_Position=1739; Antisense; GCAACCTGGCGAACAGCGATATAAA
>probe:Drosophila_2:1638779_at:504:35; Interrogation_Position=1775; Antisense; ATCAGATTTCAGTTTGGCATTACAA
>probe:Drosophila_2:1638779_at:391:5; Interrogation_Position=1816; Antisense; ATTGACTTGGATACCATTTCGGAAA
>probe:Drosophila_2:1638779_at:410:165; Interrogation_Position=1839; Antisense; AAATGCCCGATATACTTTAAAGCTA
>probe:Drosophila_2:1638779_at:187:117; Interrogation_Position=1859; Antisense; AGCTATTCTCGTTTTTACCTGTTAG
>probe:Drosophila_2:1638779_at:204:673; Interrogation_Position=1874; Antisense; TACCTGTTAGTTTTGCTTACTTTTG
>probe:Drosophila_2:1638779_at:598:343; Interrogation_Position=1944; Antisense; GCATTTGATTTCTCACCAAGTTCGG
>probe:Drosophila_2:1638779_at:194:127; Interrogation_Position=1958; Antisense; ACCAAGTTCGGTTTCAGTGCACAAA
>probe:Drosophila_2:1638779_at:703:323; Interrogation_Position=2028; Antisense; GCGAAACGCTCATTCTTAAGCCACA
>probe:Drosophila_2:1638779_at:720:249; Interrogation_Position=2051; Antisense; CAATGTGTCATTTAGTCATGGTTAC
>probe:Drosophila_2:1638779_at:502:207; Interrogation_Position=2136; Antisense; AAGCTAATGCTAACCAATTTGTCAA

Paste this into a BLAST search page for me
TAGAAAAATTTGTCCGCCAGCGAAAAACCGGACTTTATTTCTCAACAGATCAAGACAATGTTATGCAACCTGGCGGCAACCTGGCGAACAGCGATATAAAATCAGATTTCAGTTTGGCATTACAAATTGACTTGGATACCATTTCGGAAAAAATGCCCGATATACTTTAAAGCTAAGCTATTCTCGTTTTTACCTGTTAGTACCTGTTAGTTTTGCTTACTTTTGGCATTTGATTTCTCACCAAGTTCGGACCAAGTTCGGTTTCAGTGCACAAAGCGAAACGCTCATTCTTAAGCCACACAATGTGTCATTTAGTCATGGTTACAAGCTAATGCTAACCAATTTGTCAA

Full Affymetrix probeset data:

Annotations for 1638779_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720