FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638780_at:

>probe:Drosophila_2:1638780_at:141:61; Interrogation_Position=2114; Antisense; ATGTCCGAAAATCCGCAATACCTCA
>probe:Drosophila_2:1638780_at:225:103; Interrogation_Position=2172; Antisense; AGACCAATACTCACTACGCATTTCT
>probe:Drosophila_2:1638780_at:471:319; Interrogation_Position=2305; Antisense; GCCGCATCGCGGTAAGTTTAACAAT
>probe:Drosophila_2:1638780_at:436:477; Interrogation_Position=2320; Antisense; GTTTAACAATGCACTTCTGGAGCTG
>probe:Drosophila_2:1638780_at:365:287; Interrogation_Position=2401; Antisense; CGGCATTTGCGCCACCAAAGAGGAT
>probe:Drosophila_2:1638780_at:337:171; Interrogation_Position=2417; Antisense; AAAGAGGATGCTCCCGATGCGACAC
>probe:Drosophila_2:1638780_at:23:447; Interrogation_Position=2432; Antisense; GATGCGACACCTTTGGACATGAATA
>probe:Drosophila_2:1638780_at:355:323; Interrogation_Position=2499; Antisense; GCGCCCTGCTTTACGGGATTATCAG
>probe:Drosophila_2:1638780_at:636:15; Interrogation_Position=2516; Antisense; ATTATCAGCTGGGTTTTGTTCGTAA
>probe:Drosophila_2:1638780_at:218:107; Interrogation_Position=2544; Antisense; AGAAAGCTCATCACTACCGAGTTCC
>probe:Drosophila_2:1638780_at:592:435; Interrogation_Position=2588; Antisense; GAGGAGTTCCAGTTCGTTATCGATT
>probe:Drosophila_2:1638780_at:312:531; Interrogation_Position=2628; Antisense; GGGTATTGAAAAACTCCGCTTCCAT
>probe:Drosophila_2:1638780_at:340:87; Interrogation_Position=2663; Antisense; AGTCGCCAGTCCTCGATGTCAGTAG
>probe:Drosophila_2:1638780_at:649:495; Interrogation_Position=2680; Antisense; GTCAGTAGCTTCTGTGGCCCAGGAA

Paste this into a BLAST search page for me
ATGTCCGAAAATCCGCAATACCTCAAGACCAATACTCACTACGCATTTCTGCCGCATCGCGGTAAGTTTAACAATGTTTAACAATGCACTTCTGGAGCTGCGGCATTTGCGCCACCAAAGAGGATAAAGAGGATGCTCCCGATGCGACACGATGCGACACCTTTGGACATGAATAGCGCCCTGCTTTACGGGATTATCAGATTATCAGCTGGGTTTTGTTCGTAAAGAAAGCTCATCACTACCGAGTTCCGAGGAGTTCCAGTTCGTTATCGATTGGGTATTGAAAAACTCCGCTTCCATAGTCGCCAGTCCTCGATGTCAGTAGGTCAGTAGCTTCTGTGGCCCAGGAA

Full Affymetrix probeset data:

Annotations for 1638780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720