FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638781_at:

>probe:Drosophila_2:1638781_at:684:429; Interrogation_Position=312; Antisense; GAGTCGGGCTTTAATCTGTCCAACG
>probe:Drosophila_2:1638781_at:60:95; Interrogation_Position=373; Antisense; AGTTCCATGTCCAGGGTCCCAAGGA
>probe:Drosophila_2:1638781_at:64:555; Interrogation_Position=403; Antisense; GGACCGTCTATTTCTGGGCCTCAAA
>probe:Drosophila_2:1638781_at:195:43; Interrogation_Position=450; Antisense; ATCGATCGCCTGGAGCTCGAAACGA
>probe:Drosophila_2:1638781_at:4:387; Interrogation_Position=485; Antisense; GAACACACGCTACCTGCTTAAGAAG
>probe:Drosophila_2:1638781_at:334:385; Interrogation_Position=515; Antisense; GAACTACTCGCTGGTCAGCAGTGAT
>probe:Drosophila_2:1638781_at:512:113; Interrogation_Position=531; Antisense; AGCAGTGATGGTGATCCGGATCCCC
>probe:Drosophila_2:1638781_at:469:553; Interrogation_Position=635; Antisense; GGAGCAGGAGCCGACAGTCCATCAG
>probe:Drosophila_2:1638781_at:458:649; Interrogation_Position=656; Antisense; TCAGCACCCCAGTATTCAGAACAAT
>probe:Drosophila_2:1638781_at:176:689; Interrogation_Position=668; Antisense; TATTCAGAACAATCCTCCGCAACAA
>probe:Drosophila_2:1638781_at:298:85; Interrogation_Position=719; Antisense; AGTGCCTCACGTTCATACGGCGGAG
>probe:Drosophila_2:1638781_at:352:525; Interrogation_Position=758; Antisense; GGGCAACTCTCAGGAAGAGCTTTTC
>probe:Drosophila_2:1638781_at:421:677; Interrogation_Position=808; Antisense; TAGTTCAATTACTCAGTGCTTTCAG
>probe:Drosophila_2:1638781_at:363:509; Interrogation_Position=823; Antisense; GTGCTTTCAGTTTATCCACCTGATT

Paste this into a BLAST search page for me
GAGTCGGGCTTTAATCTGTCCAACGAGTTCCATGTCCAGGGTCCCAAGGAGGACCGTCTATTTCTGGGCCTCAAAATCGATCGCCTGGAGCTCGAAACGAGAACACACGCTACCTGCTTAAGAAGGAACTACTCGCTGGTCAGCAGTGATAGCAGTGATGGTGATCCGGATCCCCGGAGCAGGAGCCGACAGTCCATCAGTCAGCACCCCAGTATTCAGAACAATTATTCAGAACAATCCTCCGCAACAAAGTGCCTCACGTTCATACGGCGGAGGGGCAACTCTCAGGAAGAGCTTTTCTAGTTCAATTACTCAGTGCTTTCAGGTGCTTTCAGTTTATCCACCTGATT

Full Affymetrix probeset data:

Annotations for 1638781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720