Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638783_at:

>probe:Drosophila_2:1638783_at:266:633; Interrogation_Position=200; Antisense; TCCCGCAGTACGAGAGCCTGAATGT
>probe:Drosophila_2:1638783_at:572:669; Interrogation_Position=238; Antisense; TACGACTACCCGCAGCTGGAGAGCT
>probe:Drosophila_2:1638783_at:154:99; Interrogation_Position=266; Antisense; AGAGGTTTCTGCACGGATTGGCCGA
>probe:Drosophila_2:1638783_at:712:1; Interrogation_Position=282; Antisense; ATTGGCCGAGTACCTGGACTTGGAC
>probe:Drosophila_2:1638783_at:680:585; Interrogation_Position=296; Antisense; TGGACTTGGACGTCTCCGACTGCTA
>probe:Drosophila_2:1638783_at:442:629; Interrogation_Position=367; Antisense; TCCACGGTCATCGAATCGGAGTACA
>probe:Drosophila_2:1638783_at:605:549; Interrogation_Position=384; Antisense; GGAGTACAAGCTGACCACCTACGAG
>probe:Drosophila_2:1638783_at:87:187; Interrogation_Position=424; Antisense; AACAATGTGGATGCGCCAGTCTATC
>probe:Drosophila_2:1638783_at:298:77; Interrogation_Position=506; Antisense; AGGAGTACACCGACGACTGCGAGGA
>probe:Drosophila_2:1638783_at:717:139; Interrogation_Position=539; Antisense; ACGTGCCCGACAAGGAGCTGCTCGA
>probe:Drosophila_2:1638783_at:66:323; Interrogation_Position=622; Antisense; GCGCCTCCGATTTGGCAAACATTTA
>probe:Drosophila_2:1638783_at:124:173; Interrogation_Position=714; Antisense; AAAGCTTTGCACTAACTGGGACGGC
>probe:Drosophila_2:1638783_at:478:693; Interrogation_Position=745; Antisense; TTAGCCGCCGTTTACAGAAGTTAAT
>probe:Drosophila_2:1638783_at:656:239; Interrogation_Position=775; Antisense; AATACAATTTCACGTGTCTCTTTTA

Paste this into a BLAST search page for me
TCCCGCAGTACGAGAGCCTGAATGTTACGACTACCCGCAGCTGGAGAGCTAGAGGTTTCTGCACGGATTGGCCGAATTGGCCGAGTACCTGGACTTGGACTGGACTTGGACGTCTCCGACTGCTATCCACGGTCATCGAATCGGAGTACAGGAGTACAAGCTGACCACCTACGAGAACAATGTGGATGCGCCAGTCTATCAGGAGTACACCGACGACTGCGAGGAACGTGCCCGACAAGGAGCTGCTCGAGCGCCTCCGATTTGGCAAACATTTAAAAGCTTTGCACTAACTGGGACGGCTTAGCCGCCGTTTACAGAAGTTAATAATACAATTTCACGTGTCTCTTTTA

Full Affymetrix probeset data:

Annotations for 1638783_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime