Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638784_s_at:

>probe:Drosophila_2:1638784_s_at:343:497; Interrogation_Position=173; Antisense; GTCAGGACTAACTTACAGAGAGATC
>probe:Drosophila_2:1638784_s_at:654:427; Interrogation_Position=192; Antisense; GAGATCAATGGCGACCTATTCAAAT
>probe:Drosophila_2:1638784_s_at:563:81; Interrogation_Position=222; Antisense; AGGGATTATTCCATGTGCCACTGCG
>probe:Drosophila_2:1638784_s_at:584:259; Interrogation_Position=240; Antisense; CACTGCGTGGCTGCCGATTTGCGAA
>probe:Drosophila_2:1638784_s_at:56:439; Interrogation_Position=271; Antisense; GAGGCATAGCTGTAAAGTTTCGGTA
>probe:Drosophila_2:1638784_s_at:133:471; Interrogation_Position=287; Antisense; GTTTCGGTAGGTAATGGCTTAGTGT
>probe:Drosophila_2:1638784_s_at:304:589; Interrogation_Position=323; Antisense; TGGTAAATTTGCCTATTTTCCAGAA
>probe:Drosophila_2:1638784_s_at:327:395; Interrogation_Position=378; Antisense; GACAAAATGTTCAGCCAGGCGGCGT
>probe:Drosophila_2:1638784_s_at:251:505; Interrogation_Position=407; Antisense; GTCCTTCAGGACCAGCAGCGATTTA
>probe:Drosophila_2:1638784_s_at:199:555; Interrogation_Position=415; Antisense; GGACCAGCAGCGATTTATTTACTAT
>probe:Drosophila_2:1638784_s_at:281:101; Interrogation_Position=489; Antisense; AGAGTTCCTTGATCGCCATGCGAAA
>probe:Drosophila_2:1638784_s_at:598:25; Interrogation_Position=555; Antisense; ATACGAATCTTTCTACCATTTGCAG
>probe:Drosophila_2:1638784_s_at:654:721; Interrogation_Position=617; Antisense; TTGGATGCGGTTTGGATGGCCTAAA
>probe:Drosophila_2:1638784_s_at:706:651; Interrogation_Position=662; Antisense; TAATTTGCCAGGTTTTTCAAGCGGA

Paste this into a BLAST search page for me
GTCAGGACTAACTTACAGAGAGATCGAGATCAATGGCGACCTATTCAAATAGGGATTATTCCATGTGCCACTGCGCACTGCGTGGCTGCCGATTTGCGAAGAGGCATAGCTGTAAAGTTTCGGTAGTTTCGGTAGGTAATGGCTTAGTGTTGGTAAATTTGCCTATTTTCCAGAAGACAAAATGTTCAGCCAGGCGGCGTGTCCTTCAGGACCAGCAGCGATTTAGGACCAGCAGCGATTTATTTACTATAGAGTTCCTTGATCGCCATGCGAAAATACGAATCTTTCTACCATTTGCAGTTGGATGCGGTTTGGATGGCCTAAATAATTTGCCAGGTTTTTCAAGCGGA

Full Affymetrix probeset data:

Annotations for 1638784_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime