Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638785_at:

>probe:Drosophila_2:1638785_at:692:87; Interrogation_Position=1275; Antisense; AGTCGTTTCATCTCTACTAAGCTCG
>probe:Drosophila_2:1638785_at:523:543; Interrogation_Position=1449; Antisense; GGATAATCCTGGCTATGTCTACGTG
>probe:Drosophila_2:1638785_at:569:59; Interrogation_Position=1463; Antisense; ATGTCTACGTGTTCGAAACCTCTTC
>probe:Drosophila_2:1638785_at:226:203; Interrogation_Position=1479; Antisense; AACCTCTTCCGGATATGCATATGTG
>probe:Drosophila_2:1638785_at:585:373; Interrogation_Position=1543; Antisense; GAAGTTCTATTTCGACCCGAGCAGC
>probe:Drosophila_2:1638785_at:464:689; Interrogation_Position=1568; Antisense; TATTCTACACGCACTTACATCGCAA
>probe:Drosophila_2:1638785_at:546:279; Interrogation_Position=1609; Antisense; CTCTTCAGACTTCGATTCCTTAGGA
>probe:Drosophila_2:1638785_at:558:521; Interrogation_Position=1631; Antisense; GGATCCTGGAAACTGGTGTCTACCG
>probe:Drosophila_2:1638785_at:16:517; Interrogation_Position=1646; Antisense; GTGTCTACCGGAAGCAGCGCAGCTA
>probe:Drosophila_2:1638785_at:644:123; Interrogation_Position=1661; Antisense; AGCGCAGCTACTGGGTGCACATGAA
>probe:Drosophila_2:1638785_at:154:615; Interrogation_Position=1682; Antisense; TGAAGCTGCACTGCGTGGCCCAGAA
>probe:Drosophila_2:1638785_at:680:107; Interrogation_Position=1703; Antisense; AGAACTTCGTCATCACCGTGGGAAT
>probe:Drosophila_2:1638785_at:620:397; Interrogation_Position=1768; Antisense; GACATCCTGGTCGTGGTAATCCTGC
>probe:Drosophila_2:1638785_at:284:383; Interrogation_Position=1798; Antisense; GAACTGGCCTGGAAGCGCTTTTTCA

Paste this into a BLAST search page for me
AGTCGTTTCATCTCTACTAAGCTCGGGATAATCCTGGCTATGTCTACGTGATGTCTACGTGTTCGAAACCTCTTCAACCTCTTCCGGATATGCATATGTGGAAGTTCTATTTCGACCCGAGCAGCTATTCTACACGCACTTACATCGCAACTCTTCAGACTTCGATTCCTTAGGAGGATCCTGGAAACTGGTGTCTACCGGTGTCTACCGGAAGCAGCGCAGCTAAGCGCAGCTACTGGGTGCACATGAATGAAGCTGCACTGCGTGGCCCAGAAAGAACTTCGTCATCACCGTGGGAATGACATCCTGGTCGTGGTAATCCTGCGAACTGGCCTGGAAGCGCTTTTTCA

Full Affymetrix probeset data:

Annotations for 1638785_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime