Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638788_at:

>probe:Drosophila_2:1638788_at:662:641; Interrogation_Position=1018; Antisense; TCTCACTACGTTTCCGGTGGCACTG
>probe:Drosophila_2:1638788_at:252:143; Interrogation_Position=1048; Antisense; ACTGGTGGCAGCTACACTACGACCT
>probe:Drosophila_2:1638788_at:157:575; Interrogation_Position=1093; Antisense; GGCGGAATCACAGGAGGAGTCATCT
>probe:Drosophila_2:1638788_at:192:431; Interrogation_Position=1109; Antisense; GAGTCATCTCCGGTGGCAACATCAT
>probe:Drosophila_2:1638788_at:435:653; Interrogation_Position=1133; Antisense; TCAAGAATGCCCAGAGTGCCACCTA
>probe:Drosophila_2:1638788_at:605:241; Interrogation_Position=1204; Antisense; AATAGCCACCAATTTTACTGTACAG
>probe:Drosophila_2:1638788_at:466:371; Interrogation_Position=729; Antisense; GAAGGACAACCAGCTGGAGGTCAAC
>probe:Drosophila_2:1638788_at:160:163; Interrogation_Position=808; Antisense; AAATACAAGACCGACGCCGAGGCCT
>probe:Drosophila_2:1638788_at:439:245; Interrogation_Position=849; Antisense; AATTCAGGCCGAATACGACAGGATC
>probe:Drosophila_2:1638788_at:509:73; Interrogation_Position=876; Antisense; AGGAACTTCAGAGCACCAGGATGGT
>probe:Drosophila_2:1638788_at:282:281; Interrogation_Position=914; Antisense; CTCAGTCGGTTGTTGGCATTTTGGA
>probe:Drosophila_2:1638788_at:106:519; Interrogation_Position=941; Antisense; GTGGTGCTATTGGTGCCGCAAGCTC
>probe:Drosophila_2:1638788_at:476:205; Interrogation_Position=960; Antisense; AAGCTCTGGCAGCTCTAACTACGTT
>probe:Drosophila_2:1638788_at:566:297; Interrogation_Position=973; Antisense; TCTAACTACGTTTCCGGAGGCACTA

Paste this into a BLAST search page for me
TCTCACTACGTTTCCGGTGGCACTGACTGGTGGCAGCTACACTACGACCTGGCGGAATCACAGGAGGAGTCATCTGAGTCATCTCCGGTGGCAACATCATTCAAGAATGCCCAGAGTGCCACCTAAATAGCCACCAATTTTACTGTACAGGAAGGACAACCAGCTGGAGGTCAACAAATACAAGACCGACGCCGAGGCCTAATTCAGGCCGAATACGACAGGATCAGGAACTTCAGAGCACCAGGATGGTCTCAGTCGGTTGTTGGCATTTTGGAGTGGTGCTATTGGTGCCGCAAGCTCAAGCTCTGGCAGCTCTAACTACGTTTCTAACTACGTTTCCGGAGGCACTA

Full Affymetrix probeset data:

Annotations for 1638788_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime