FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638790_at:

>probe:Drosophila_2:1638790_at:102:715; Interrogation_Position=2179; Antisense; TTCTCTCTTCTTCTTCGCGGTTTCG
>probe:Drosophila_2:1638790_at:204:633; Interrogation_Position=2193; Antisense; TCGCGGTTTCGTCCTGCTGCTGGCT
>probe:Drosophila_2:1638790_at:414:15; Interrogation_Position=2232; Antisense; ATTTTATATCGCTGCCTCCTTTTTC
>probe:Drosophila_2:1638790_at:261:701; Interrogation_Position=2251; Antisense; TTTTTCTGCGCGACGACGAATGCGA
>probe:Drosophila_2:1638790_at:677:623; Interrogation_Position=2271; Antisense; TGCGAAGCCAAAACCGAACGCTTTT
>probe:Drosophila_2:1638790_at:327:359; Interrogation_Position=2313; Antisense; GAAGGACTTGGCTTGAGGTCGCCTT
>probe:Drosophila_2:1638790_at:13:721; Interrogation_Position=2336; Antisense; TTGACTCGCCTTCACCAATAAGATT
>probe:Drosophila_2:1638790_at:638:649; Interrogation_Position=2354; Antisense; TAAGATTTTCGCTAGGTAACATTTG
>probe:Drosophila_2:1638790_at:396:541; Interrogation_Position=2385; Antisense; GGATATCGTGAAATGGTCGGGCTAT
>probe:Drosophila_2:1638790_at:730:53; Interrogation_Position=2397; Antisense; ATGGTCGGGCTATATAACAGGAGGA
>probe:Drosophila_2:1638790_at:75:209; Interrogation_Position=2479; Antisense; CAGAGTTTTGACTGGGAGTACCTCC
>probe:Drosophila_2:1638790_at:205:431; Interrogation_Position=2494; Antisense; GAGTACCTCCCCAAAAGTAAGATAT
>probe:Drosophila_2:1638790_at:526:657; Interrogation_Position=2521; Antisense; TAAAATCGGTTTCTTCACAATAAAG
>probe:Drosophila_2:1638790_at:160:19; Interrogation_Position=2653; Antisense; ATTTCATTTGGTTAAGGCTTATTCA

Paste this into a BLAST search page for me
TTCTCTCTTCTTCTTCGCGGTTTCGTCGCGGTTTCGTCCTGCTGCTGGCTATTTTATATCGCTGCCTCCTTTTTCTTTTTCTGCGCGACGACGAATGCGATGCGAAGCCAAAACCGAACGCTTTTGAAGGACTTGGCTTGAGGTCGCCTTTTGACTCGCCTTCACCAATAAGATTTAAGATTTTCGCTAGGTAACATTTGGGATATCGTGAAATGGTCGGGCTATATGGTCGGGCTATATAACAGGAGGACAGAGTTTTGACTGGGAGTACCTCCGAGTACCTCCCCAAAAGTAAGATATTAAAATCGGTTTCTTCACAATAAAGATTTCATTTGGTTAAGGCTTATTCA

Full Affymetrix probeset data:

Annotations for 1638790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720