FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638793_at:

>probe:Drosophila_2:1638793_at:541:611; Interrogation_Position=295; Antisense; TGAAAACACAGGAACCCAAAGGAAG
>probe:Drosophila_2:1638793_at:517:561; Interrogation_Position=315; Antisense; GGAAGGATGGAAAGCAACTGGATTC
>probe:Drosophila_2:1638793_at:4:465; Interrogation_Position=335; Antisense; GATTCCAAATTGAGTTCCACAGTCC
>probe:Drosophila_2:1638793_at:51:609; Interrogation_Position=345; Antisense; TGAGTTCCACAGTCCAAAATACAGA
>probe:Drosophila_2:1638793_at:114:667; Interrogation_Position=364; Antisense; TACAGAAGCAGCGAGGTCCAAAGAA
>probe:Drosophila_2:1638793_at:633:319; Interrogation_Position=374; Antisense; GCGAGGTCCAAAGAAACTCCTGCAC
>probe:Drosophila_2:1638793_at:367:391; Interrogation_Position=386; Antisense; GAAACTCCTGCACCCAAGAAGAATG
>probe:Drosophila_2:1638793_at:671:229; Interrogation_Position=407; Antisense; AATGTTAAGAAACTGCAGGCTGCAC
>probe:Drosophila_2:1638793_at:51:179; Interrogation_Position=416; Antisense; AAACTGCAGGCTGCACTTCCGTGCG
>probe:Drosophila_2:1638793_at:545:303; Interrogation_Position=441; Antisense; CCGACGCGGCTGCAAATCTTTTGGA
>probe:Drosophila_2:1638793_at:541:35; Interrogation_Position=456; Antisense; ATCTTTTGGAGGAACAAGCATCTAA
>probe:Drosophila_2:1638793_at:578:165; Interrogation_Position=483; Antisense; AAATGAATGAAGAAGGACCTCCTGT
>probe:Drosophila_2:1638793_at:481:509; Interrogation_Position=521; Antisense; GTGAAGAAACTTCCGGCTGCACGTC
>probe:Drosophila_2:1638793_at:219:179; Interrogation_Position=527; Antisense; AAACTTCCGGCTGCACGTCAGTGTG

Paste this into a BLAST search page for me
TGAAAACACAGGAACCCAAAGGAAGGGAAGGATGGAAAGCAACTGGATTCGATTCCAAATTGAGTTCCACAGTCCTGAGTTCCACAGTCCAAAATACAGATACAGAAGCAGCGAGGTCCAAAGAAGCGAGGTCCAAAGAAACTCCTGCACGAAACTCCTGCACCCAAGAAGAATGAATGTTAAGAAACTGCAGGCTGCACAAACTGCAGGCTGCACTTCCGTGCGCCGACGCGGCTGCAAATCTTTTGGAATCTTTTGGAGGAACAAGCATCTAAAAATGAATGAAGAAGGACCTCCTGTGTGAAGAAACTTCCGGCTGCACGTCAAACTTCCGGCTGCACGTCAGTGTG

Full Affymetrix probeset data:

Annotations for 1638793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720