FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638796_at:

>probe:Drosophila_2:1638796_at:139:287; Interrogation_Position=1045; Antisense; CTGGACTACATGATGGAGGCGCTCT
>probe:Drosophila_2:1638796_at:313:207; Interrogation_Position=1073; Antisense; AAGCTCTCCAGCTCATCAGAGTGTA
>probe:Drosophila_2:1638796_at:403:515; Interrogation_Position=1093; Antisense; GTGTACACAAAGAAGCCAGGCGCTC
>probe:Drosophila_2:1638796_at:386:337; Interrogation_Position=1114; Antisense; GCTCCTCCAGACTTTGACGATGGAT
>probe:Drosophila_2:1638796_at:204:293; Interrogation_Position=1155; Antisense; CGTCAGTGTGGAGCATGTGTGCCAT
>probe:Drosophila_2:1638796_at:28:577; Interrogation_Position=1200; Antisense; GGCGCAGTTCAAGTATGCCCTGGTG
>probe:Drosophila_2:1638796_at:637:541; Interrogation_Position=1262; Antisense; GGATTGCCCATGTGATGGCCGACGA
>probe:Drosophila_2:1638796_at:691:137; Interrogation_Position=1283; Antisense; ACGAGGACGTCATCCAGGTGGTGAA
>probe:Drosophila_2:1638796_at:123:719; Interrogation_Position=798; Antisense; TTCCCTTACGCGCTGCAACGAGAAA
>probe:Drosophila_2:1638796_at:358:653; Interrogation_Position=848; Antisense; TCAAGATCTTCAACGCCGAGGTGCT
>probe:Drosophila_2:1638796_at:65:645; Interrogation_Position=872; Antisense; TCTTCCGCGAAGACTGCACCGAGGA
>probe:Drosophila_2:1638796_at:441:137; Interrogation_Position=896; Antisense; ACGAGTTCATCGACGTGGTCACCGC
>probe:Drosophila_2:1638796_at:432:39; Interrogation_Position=932; Antisense; ATCTGCCCTGTCTGTATGTCTACAA
>probe:Drosophila_2:1638796_at:58:323; Interrogation_Position=999; Antisense; GCGCCAGCCAAACTCGATAGTGGTT

Paste this into a BLAST search page for me
CTGGACTACATGATGGAGGCGCTCTAAGCTCTCCAGCTCATCAGAGTGTAGTGTACACAAAGAAGCCAGGCGCTCGCTCCTCCAGACTTTGACGATGGATCGTCAGTGTGGAGCATGTGTGCCATGGCGCAGTTCAAGTATGCCCTGGTGGGATTGCCCATGTGATGGCCGACGAACGAGGACGTCATCCAGGTGGTGAATTCCCTTACGCGCTGCAACGAGAAATCAAGATCTTCAACGCCGAGGTGCTTCTTCCGCGAAGACTGCACCGAGGAACGAGTTCATCGACGTGGTCACCGCATCTGCCCTGTCTGTATGTCTACAAGCGCCAGCCAAACTCGATAGTGGTT

Full Affymetrix probeset data:

Annotations for 1638796_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720