FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638799_at:

>probe:Drosophila_2:1638799_at:365:561; Interrogation_Position=175; Antisense; GGAACCGTCGTTTACAAATGCCAAG
>probe:Drosophila_2:1638799_at:297:89; Interrogation_Position=198; Antisense; AGTACCTTATAGTTCCACCTACGAG
>probe:Drosophila_2:1638799_at:614:725; Interrogation_Position=242; Antisense; TTGATCTAATCAACACCGCCACAGT
>probe:Drosophila_2:1638799_at:297:173; Interrogation_Position=299; Antisense; AAAGCGACTGTGAGCGATCCCTGCG
>probe:Drosophila_2:1638799_at:326:355; Interrogation_Position=323; Antisense; GCACTTCGCTTTCATACGGTCAGTT
>probe:Drosophila_2:1638799_at:368:27; Interrogation_Position=336; Antisense; ATACGGTCAGTTCTGCGCTGGACAA
>probe:Drosophila_2:1638799_at:190:269; Interrogation_Position=389; Antisense; CAGGCGGTCCGCTGTCGAGGAAAAT
>probe:Drosophila_2:1638799_at:472:399; Interrogation_Position=42; Antisense; GACACGCATCGATTGTACATCTGAG
>probe:Drosophila_2:1638799_at:504:691; Interrogation_Position=450; Antisense; TATTGTCAGCTATGGTCACTACTTG
>probe:Drosophila_2:1638799_at:170:647; Interrogation_Position=465; Antisense; TCACTACTTGTGTCGAGGGCCAGGA
>probe:Drosophila_2:1638799_at:320:431; Interrogation_Position=488; Antisense; GAGTCTACACATACGTTCCAAGTTT
>probe:Drosophila_2:1638799_at:49:545; Interrogation_Position=521; Antisense; GGATACTCAGTATTACCCGCTGGAC
>probe:Drosophila_2:1638799_at:155:41; Interrogation_Position=60; Antisense; ATCTGAGTTCTGTATTCCGACGTAT
>probe:Drosophila_2:1638799_at:674:677; Interrogation_Position=98; Antisense; TAGAGAACGCCTACATCCATACATT

Paste this into a BLAST search page for me
GGAACCGTCGTTTACAAATGCCAAGAGTACCTTATAGTTCCACCTACGAGTTGATCTAATCAACACCGCCACAGTAAAGCGACTGTGAGCGATCCCTGCGGCACTTCGCTTTCATACGGTCAGTTATACGGTCAGTTCTGCGCTGGACAACAGGCGGTCCGCTGTCGAGGAAAATGACACGCATCGATTGTACATCTGAGTATTGTCAGCTATGGTCACTACTTGTCACTACTTGTGTCGAGGGCCAGGAGAGTCTACACATACGTTCCAAGTTTGGATACTCAGTATTACCCGCTGGACATCTGAGTTCTGTATTCCGACGTATTAGAGAACGCCTACATCCATACATT

Full Affymetrix probeset data:

Annotations for 1638799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720